ID: 1160880020

View in Genome Browser
Species Human (GRCh38)
Location 19:1315502-1315524
Sequence TGCCAATGCCAGCATGGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160880020_1160880028 23 Left 1160880020 19:1315502-1315524 CCACGGCCATGCTGGCATTGGCA No data
Right 1160880028 19:1315548-1315570 CCAGGTCCCCAGCAGGACTGCGG No data
1160880020_1160880025 16 Left 1160880020 19:1315502-1315524 CCACGGCCATGCTGGCATTGGCA No data
Right 1160880025 19:1315541-1315563 GACCTGTCCAGGTCCCCAGCAGG No data
1160880020_1160880023 5 Left 1160880020 19:1315502-1315524 CCACGGCCATGCTGGCATTGGCA No data
Right 1160880023 19:1315530-1315552 GGTCCAGCTCAGACCTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160880020 Original CRISPR TGCCAATGCCAGCATGGCCG TGG (reversed) Intergenic
No off target data available for this crispr