ID: 1160880021

View in Genome Browser
Species Human (GRCh38)
Location 19:1315508-1315530
Sequence CAGTGCTGCCAATGCCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160880021_1160880032 26 Left 1160880021 19:1315508-1315530 CCATGCTGGCATTGGCAGCACTG No data
Right 1160880032 19:1315557-1315579 CAGCAGGACTGCGGTGCGCCTGG No data
1160880021_1160880023 -1 Left 1160880021 19:1315508-1315530 CCATGCTGGCATTGGCAGCACTG No data
Right 1160880023 19:1315530-1315552 GGTCCAGCTCAGACCTGTCCAGG No data
1160880021_1160880028 17 Left 1160880021 19:1315508-1315530 CCATGCTGGCATTGGCAGCACTG No data
Right 1160880028 19:1315548-1315570 CCAGGTCCCCAGCAGGACTGCGG No data
1160880021_1160880025 10 Left 1160880021 19:1315508-1315530 CCATGCTGGCATTGGCAGCACTG No data
Right 1160880025 19:1315541-1315563 GACCTGTCCAGGTCCCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160880021 Original CRISPR CAGTGCTGCCAATGCCAGCA TGG (reversed) Intergenic
No off target data available for this crispr