ID: 1160880025

View in Genome Browser
Species Human (GRCh38)
Location 19:1315541-1315563
Sequence GACCTGTCCAGGTCCCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160880021_1160880025 10 Left 1160880021 19:1315508-1315530 CCATGCTGGCATTGGCAGCACTG No data
Right 1160880025 19:1315541-1315563 GACCTGTCCAGGTCCCCAGCAGG No data
1160880020_1160880025 16 Left 1160880020 19:1315502-1315524 CCACGGCCATGCTGGCATTGGCA No data
Right 1160880025 19:1315541-1315563 GACCTGTCCAGGTCCCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160880025 Original CRISPR GACCTGTCCAGGTCCCCAGC AGG Intergenic
No off target data available for this crispr