ID: 1160880095

View in Genome Browser
Species Human (GRCh38)
Location 19:1315802-1315824
Sequence AGCCGCGGGGGGGCCAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160880095_1160880113 16 Left 1160880095 19:1315802-1315824 CCCTCTCTGGCCCCCCCGCGGCT No data
Right 1160880113 19:1315841-1315863 GCTAGGTGGAGCGAGGAGGCCGG No data
1160880095_1160880111 12 Left 1160880095 19:1315802-1315824 CCCTCTCTGGCCCCCCCGCGGCT No data
Right 1160880111 19:1315837-1315859 CGCCGCTAGGTGGAGCGAGGAGG No data
1160880095_1160880115 27 Left 1160880095 19:1315802-1315824 CCCTCTCTGGCCCCCCCGCGGCT No data
Right 1160880115 19:1315852-1315874 CGAGGAGGCCGGTGGAGACGCGG No data
1160880095_1160880108 2 Left 1160880095 19:1315802-1315824 CCCTCTCTGGCCCCCCCGCGGCT No data
Right 1160880108 19:1315827-1315849 GGGCTCAGGCCGCCGCTAGGTGG No data
1160880095_1160880109 9 Left 1160880095 19:1315802-1315824 CCCTCTCTGGCCCCCCCGCGGCT No data
Right 1160880109 19:1315834-1315856 GGCCGCCGCTAGGTGGAGCGAGG No data
1160880095_1160880106 -1 Left 1160880095 19:1315802-1315824 CCCTCTCTGGCCCCCCCGCGGCT No data
Right 1160880106 19:1315824-1315846 TCCGGGCTCAGGCCGCCGCTAGG No data
1160880095_1160880114 19 Left 1160880095 19:1315802-1315824 CCCTCTCTGGCCCCCCCGCGGCT No data
Right 1160880114 19:1315844-1315866 AGGTGGAGCGAGGAGGCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160880095 Original CRISPR AGCCGCGGGGGGGCCAGAGA GGG (reversed) Intergenic
No off target data available for this crispr