ID: 1160880290

View in Genome Browser
Species Human (GRCh38)
Location 19:1316556-1316578
Sequence CCTGCCTTGCAGGGGCAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160880290_1160880300 3 Left 1160880290 19:1316556-1316578 CCCTACTGCCCCTGCAAGGCAGG No data
Right 1160880300 19:1316582-1316604 GGTGATCCGTGTGCACCCTGGGG No data
1160880290_1160880299 2 Left 1160880290 19:1316556-1316578 CCCTACTGCCCCTGCAAGGCAGG No data
Right 1160880299 19:1316581-1316603 TGGTGATCCGTGTGCACCCTGGG No data
1160880290_1160880305 19 Left 1160880290 19:1316556-1316578 CCCTACTGCCCCTGCAAGGCAGG No data
Right 1160880305 19:1316598-1316620 CCTGGGGGCCGTCTCATGTGTGG No data
1160880290_1160880298 1 Left 1160880290 19:1316556-1316578 CCCTACTGCCCCTGCAAGGCAGG No data
Right 1160880298 19:1316580-1316602 CTGGTGATCCGTGTGCACCCTGG No data
1160880290_1160880301 4 Left 1160880290 19:1316556-1316578 CCCTACTGCCCCTGCAAGGCAGG No data
Right 1160880301 19:1316583-1316605 GTGATCCGTGTGCACCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160880290 Original CRISPR CCTGCCTTGCAGGGGCAGTA GGG (reversed) Intergenic
No off target data available for this crispr