ID: 1160881898

View in Genome Browser
Species Human (GRCh38)
Location 19:1324825-1324847
Sequence CCCCCCGCACACGCGGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160881898_1160881909 25 Left 1160881898 19:1324825-1324847 CCTGTGCCCGCGTGTGCGGGGGG No data
Right 1160881909 19:1324873-1324895 CCAGCCCCTTTTCCCGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160881898 Original CRISPR CCCCCCGCACACGCGGGCAC AGG (reversed) Intergenic
No off target data available for this crispr