ID: 1160885874

View in Genome Browser
Species Human (GRCh38)
Location 19:1347628-1347650
Sequence CTCCCACAACACGGAATCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160885863_1160885874 13 Left 1160885863 19:1347592-1347614 CCTGTTCCCATGATTCACTCGCC No data
Right 1160885874 19:1347628-1347650 CTCCCACAACACGGAATCGTGGG No data
1160885867_1160885874 -8 Left 1160885867 19:1347613-1347635 CCTCCCACAAGGTCCCTCCCACA 0: 9
1: 687
2: 2412
3: 4545
4: 6706
Right 1160885874 19:1347628-1347650 CTCCCACAACACGGAATCGTGGG No data
1160885865_1160885874 6 Left 1160885865 19:1347599-1347621 CCATGATTCACTCGCCTCCCACA No data
Right 1160885874 19:1347628-1347650 CTCCCACAACACGGAATCGTGGG No data
1160885864_1160885874 7 Left 1160885864 19:1347598-1347620 CCCATGATTCACTCGCCTCCCAC No data
Right 1160885874 19:1347628-1347650 CTCCCACAACACGGAATCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160885874 Original CRISPR CTCCCACAACACGGAATCGT GGG Intergenic
No off target data available for this crispr