ID: 1160888395

View in Genome Browser
Species Human (GRCh38)
Location 19:1363391-1363413
Sequence CCATCCAGACAGGTGCCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160888395_1160888407 13 Left 1160888395 19:1363391-1363413 CCATTGGGCACCTGTCTGGATGG No data
Right 1160888407 19:1363427-1363449 GGTGCTGTGGGGCACCCATTGGG No data
1160888395_1160888400 0 Left 1160888395 19:1363391-1363413 CCATTGGGCACCTGTCTGGATGG No data
Right 1160888400 19:1363414-1363436 TCCCAGGACCGCAGGTGCTGTGG No data
1160888395_1160888404 2 Left 1160888395 19:1363391-1363413 CCATTGGGCACCTGTCTGGATGG No data
Right 1160888404 19:1363416-1363438 CCAGGACCGCAGGTGCTGTGGGG No data
1160888395_1160888399 -8 Left 1160888395 19:1363391-1363413 CCATTGGGCACCTGTCTGGATGG No data
Right 1160888399 19:1363406-1363428 CTGGATGGTCCCAGGACCGCAGG No data
1160888395_1160888406 12 Left 1160888395 19:1363391-1363413 CCATTGGGCACCTGTCTGGATGG No data
Right 1160888406 19:1363426-1363448 AGGTGCTGTGGGGCACCCATTGG No data
1160888395_1160888409 23 Left 1160888395 19:1363391-1363413 CCATTGGGCACCTGTCTGGATGG No data
Right 1160888409 19:1363437-1363459 GGCACCCATTGGGGACTTCCAGG No data
1160888395_1160888402 1 Left 1160888395 19:1363391-1363413 CCATTGGGCACCTGTCTGGATGG No data
Right 1160888402 19:1363415-1363437 CCCAGGACCGCAGGTGCTGTGGG No data
1160888395_1160888408 14 Left 1160888395 19:1363391-1363413 CCATTGGGCACCTGTCTGGATGG No data
Right 1160888408 19:1363428-1363450 GTGCTGTGGGGCACCCATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160888395 Original CRISPR CCATCCAGACAGGTGCCCAA TGG (reversed) Intronic