ID: 1160888660

View in Genome Browser
Species Human (GRCh38)
Location 19:1365290-1365312
Sequence CAGAAGCAGAGAATCTGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160888660_1160888663 2 Left 1160888660 19:1365290-1365312 CCGGGGCAGATTCTCTGCTTCTG No data
Right 1160888663 19:1365315-1365337 TCTGCAGGCCTGGAAGTTGCAGG No data
1160888660_1160888666 14 Left 1160888660 19:1365290-1365312 CCGGGGCAGATTCTCTGCTTCTG No data
Right 1160888666 19:1365327-1365349 GAAGTTGCAGGTCATTGGTTTGG No data
1160888660_1160888664 9 Left 1160888660 19:1365290-1365312 CCGGGGCAGATTCTCTGCTTCTG No data
Right 1160888664 19:1365322-1365344 GCCTGGAAGTTGCAGGTCATTGG No data
1160888660_1160888667 15 Left 1160888660 19:1365290-1365312 CCGGGGCAGATTCTCTGCTTCTG No data
Right 1160888667 19:1365328-1365350 AAGTTGCAGGTCATTGGTTTGGG No data
1160888660_1160888662 -8 Left 1160888660 19:1365290-1365312 CCGGGGCAGATTCTCTGCTTCTG No data
Right 1160888662 19:1365305-1365327 TGCTTCTGTCTCTGCAGGCCTGG No data
1160888660_1160888668 26 Left 1160888660 19:1365290-1365312 CCGGGGCAGATTCTCTGCTTCTG No data
Right 1160888668 19:1365339-1365361 CATTGGTTTGGGTGCTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160888660 Original CRISPR CAGAAGCAGAGAATCTGCCC CGG (reversed) Intronic