ID: 1160888664

View in Genome Browser
Species Human (GRCh38)
Location 19:1365322-1365344
Sequence GCCTGGAAGTTGCAGGTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160888660_1160888664 9 Left 1160888660 19:1365290-1365312 CCGGGGCAGATTCTCTGCTTCTG 0: 1
1: 0
2: 2
3: 30
4: 274
Right 1160888664 19:1365322-1365344 GCCTGGAAGTTGCAGGTCATTGG 0: 1
1: 0
2: 2
3: 14
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160888664 Original CRISPR GCCTGGAAGTTGCAGGTCAT TGG Intronic
902125331 1:14205098-14205120 GGCTGAAAGTTGCAGGTGGTAGG + Intergenic
903051330 1:20603440-20603462 GACTGGAAGGTGGAGGTGATGGG - Intronic
903480108 1:23646859-23646881 GCCTAGAGGTGGCATGTCATGGG + Intergenic
905683793 1:39894154-39894176 GCCTCAGAGTTGCTGGTCATGGG + Intergenic
906694246 1:47813507-47813529 GCCTGCATGTAGCAGGTCCTAGG - Intronic
909760312 1:79277868-79277890 GCTGGGGAGTTCCAGGTCATAGG - Intergenic
913085034 1:115429012-115429034 GGCTGGATGTTACAGGTCACAGG - Intergenic
915367967 1:155325896-155325918 TCCAGGAAGATGCAGGTCAGAGG + Exonic
919784784 1:201252249-201252271 GCCTGGGAGCTGGAGGGCATGGG - Intergenic
922166563 1:223120384-223120406 GCCTGGGGCTTCCAGGTCATAGG - Intronic
922781968 1:228259762-228259784 GCCTGCAAGTGGCAGGTCAGTGG + Exonic
923045366 1:230351654-230351676 GCCTGGAAGAAGGAGGTCGTGGG - Intronic
923474600 1:234321002-234321024 GCCTGGAAGTGGCAGGATTTGGG - Intronic
924372240 1:243363145-243363167 ACAAGGAAGCTGCAGGTCATAGG - Intronic
1063371988 10:5528037-5528059 GCCTGGATTTTGCAGGTGCTGGG + Intergenic
1064688431 10:17888329-17888351 GCCTGATAGTTGCAGCACATGGG + Intronic
1065536090 10:26716152-26716174 GCCTAGAAGTTGGAGCTCACAGG + Intronic
1068841521 10:61619847-61619869 GCCTGGAAGTTGCAGATCAGGGG - Intergenic
1071953801 10:90735086-90735108 GCCTGCAAATTGCAGATCATGGG - Intergenic
1074695012 10:116042354-116042376 GCCTGGGTGGTGCAGGACATGGG - Intergenic
1074840311 10:117344800-117344822 GCCTGGAAGTAACAGGTGACTGG - Intronic
1075813955 10:125250048-125250070 GCCAGCAAGTTTCTGGTCATTGG - Intergenic
1075972115 10:126663737-126663759 GTCTAGAACTTGCAGATCATGGG + Intronic
1076250262 10:128979385-128979407 CCCTGGAAGCTCCAGGTCCTTGG + Intergenic
1079120850 11:17683889-17683911 GCCTGGATCTTGCAGGACACGGG - Intergenic
1082988713 11:59189141-59189163 TCCTGGAAGGGGCAGGGCATGGG - Exonic
1084315480 11:68343051-68343073 GCCTGGAAGATACAGCCCATGGG + Intronic
1085099555 11:73789011-73789033 GCATGGTCGTTGCAGCTCATGGG + Intronic
1086501299 11:87456425-87456447 GCTTCCAACTTGCAGGTCATGGG - Intergenic
1089738322 11:120564628-120564650 GCCTGGAGGTGGCCGGGCATCGG + Intronic
1090429494 11:126634291-126634313 GCATGGAAAGTGCATGTCATAGG - Intronic
1095465052 12:42481602-42481624 GCATGGAAGATGCAGATCACAGG + Intronic
1095527750 12:43148164-43148186 TCCTGGAATTTACAGGTCTTAGG + Intergenic
1097045018 12:56181153-56181175 CCCTGGAAGTTGAAGTTCAAGGG + Intronic
1099601906 12:84750403-84750425 GTCTCGAAGGTGCAGGTTATAGG - Intergenic
1102041398 12:109803182-109803204 GCCTGGAAGTTCAAGGTCATGGG - Intronic
1102484021 12:113244053-113244075 GCCTGGAACTGGCAGGGGATGGG - Intronic
1103833503 12:123799827-123799849 GCCTGGCAGTTTTAGGTCTTTGG + Intronic
1106419684 13:29575835-29575857 TTCTGGAAGTTGCAGGGCAGAGG - Intronic
1111882314 13:93972767-93972789 ACCTGGAATTTGCATCTCATTGG - Intronic
1112990614 13:105509182-105509204 GCCTGGAAGTTGCTGGTTACGGG - Intergenic
1113657292 13:112075086-112075108 CCCTGGAATTTGCAGGGCAGAGG + Intergenic
1114138306 14:19879964-19879986 GCATGCAACCTGCAGGTCATGGG - Intergenic
1116215268 14:42008683-42008705 ACCCGGATGTTGCAGGTCAGAGG - Intergenic
1118870168 14:69734663-69734685 GCCTTGAAGTTGCAAGACCTGGG + Intronic
1121676218 14:95755045-95755067 GCCTGGGAGTTGTGTGTCATAGG + Intergenic
1123482347 15:20643963-20643985 GCATGGAAATTTCAGGGCATGGG + Intergenic
1125785236 15:42310634-42310656 GGCTGGATGTTGCAGGTTAGAGG + Intronic
1125835766 15:42749361-42749383 TCCTGGAAGTTGCAAGCCTTTGG - Intronic
1126382266 15:48061324-48061346 GCCTGGGAGTTCCAGGTCTTAGG + Intergenic
1133769350 16:8858798-8858820 GCCTGGCAGATGCAGGTCTCAGG - Intronic
1133940255 16:10303280-10303302 GCCTGGAAGTTACTGGTGGTTGG + Intergenic
1135293193 16:21257726-21257748 CCCTGGTAGTGGCAGGACATTGG - Intronic
1137483912 16:48875997-48876019 GCCTGGTAGCTGCAGGTGACAGG + Intergenic
1137605889 16:49786553-49786575 GCCTGGTGGCTGCAGGGCATAGG - Intronic
1140359649 16:74333445-74333467 GCCTGGAAGTTGCTCGTTACAGG + Intergenic
1143797819 17:9352072-9352094 GCCTGGAAGATGGAGGGCTTCGG + Intronic
1147912445 17:43864098-43864120 GCATGGAAGTGCCAGGTCATAGG + Intergenic
1149905322 17:60521005-60521027 GCCCAGAAGTTGGAGGTTATAGG - Intronic
1151335902 17:73439591-73439613 TCCAGGAAGTTTCAGGTCAAGGG + Intronic
1151738261 17:75960244-75960266 GCCTGGAACTTGGAGATCATTGG - Exonic
1151835427 17:76579830-76579852 GCTGGGAAGTCCCAGGTCATAGG - Intronic
1152199603 17:78937647-78937669 GCTTGGAAGTGGCATGTCATAGG - Intergenic
1152389372 17:79993588-79993610 CCCTGAAAGTTGCAGGTAGTGGG - Intronic
1158545555 18:58393324-58393346 GCCTGGAATTTGGACTTCATTGG + Intronic
1159694223 18:71534259-71534281 GCTTGGAAGATACAGGACATAGG - Intergenic
1160888664 19:1365322-1365344 GCCTGGAAGTTGCAGGTCATTGG + Intronic
1162400927 19:10446204-10446226 GCCTCGAAGCTGCAGGGGATGGG - Exonic
1167728894 19:51238509-51238531 GCCTGCAATTTCCTGGTCATTGG - Intronic
927925118 2:27006780-27006802 GCCTTGAAGTTGCCTTTCATTGG - Intronic
935130108 2:100255265-100255287 GGCTGGAAGTCTCAGGTCAGGGG + Intergenic
935548822 2:104430316-104430338 GCCTGGAGGTTGGAGGTGAAAGG - Intergenic
937294197 2:120799885-120799907 GCCTGGAAGCTGCAGGTGGTTGG + Intronic
937711234 2:124982426-124982448 GCCTGCGTGTTGCAGGGCATTGG - Intergenic
945922624 2:215771231-215771253 GGCTGAAAATTGCAGCTCATCGG + Intergenic
947805022 2:232960483-232960505 GCCTGGAAAGGGGAGGTCATGGG + Intronic
948533344 2:238627825-238627847 GCCTGCAGGTGGCAGATCATGGG + Intergenic
948648324 2:239423026-239423048 ACCAGGAAGTGGCAGGTCAGGGG + Intergenic
1169850360 20:10042529-10042551 GCCTGTATGTTACAGGTCCTGGG + Intronic
1175917328 20:62432618-62432640 GCCTGTAAGATGCAAGTCTTGGG + Intergenic
1179022408 21:37652173-37652195 ACCAGGAAGCTTCAGGTCATAGG + Intronic
1180039893 21:45270512-45270534 GCCAGGAGGTTGCAGGTGGTGGG - Intronic
1180705507 22:17807602-17807624 GCCTGGAAATTGCAGCTTATAGG - Intronic
1183750219 22:39715867-39715889 GCCAGGAAGTGGCAGGTCTGGGG - Intergenic
1184187058 22:42871910-42871932 GCCTGGAAGTTGCAGAGGAGAGG - Intronic
1184514501 22:44953656-44953678 ACCTGGAAGCTGCAGGTCTCAGG - Intronic
1185223954 22:49642709-49642731 ACCTGGGAGTCGCTGGTCATGGG - Intronic
950854666 3:16093878-16093900 GGCTGGCAGATGAAGGTCATAGG - Intergenic
953079260 3:39600142-39600164 GCCTGGTAGTTGCACATCTTTGG + Intergenic
953706608 3:45235926-45235948 GCCTGGTGGTTGGAGGTGATTGG + Intergenic
962846818 3:139280567-139280589 GCCTGGAACTTCCATCTCATAGG + Intronic
962846832 3:139280652-139280674 GCCTGGAACTTCCATCTCATAGG + Intronic
965436796 3:168662584-168662606 GTCGGGAAGTTGCTGGTCATTGG + Intergenic
967222998 3:187264923-187264945 ACCTGGCAGTTGGAGGTCCTGGG + Intronic
967983321 3:195078296-195078318 GCCAGGAAGATGCAGGGCGTTGG + Intronic
970137042 4:12936571-12936593 GCCTGGAAGCTGCCATTCATAGG - Intergenic
970606577 4:17687139-17687161 CCCTGGAAGATGGGGGTCATGGG + Intronic
971025328 4:22583892-22583914 GCCTAGAATTTGCAGGTCCCTGG - Intergenic
975800811 4:78057675-78057697 GCCGGAAAGTTGCTGGTCACTGG - Exonic
976712291 4:88085350-88085372 GCCTAGAAGTACCTGGTCATAGG - Intergenic
977725492 4:100291952-100291974 GCATGGAGGTTTTAGGTCATCGG + Intergenic
980014448 4:127632818-127632840 TCCTGGAAGTTTCAGCCCATTGG + Intronic
980534096 4:134092465-134092487 TCCAGGAAGTATCAGGTCATGGG - Intergenic
980980688 4:139652252-139652274 GGCAGGAGGGTGCAGGTCATGGG + Intergenic
981776768 4:148377683-148377705 GCCTGGAAGAGGCATCTCATGGG + Intronic
983550902 4:169016484-169016506 GTCTGGATGCTGCAGGCCATGGG - Intergenic
985493048 5:190272-190294 GCTTGGAGGGTGCTGGTCATGGG - Intergenic
985686675 5:1285069-1285091 GTCTGGATGGTGCAGGTCAGGGG - Intronic
985686704 5:1285190-1285212 GTCTGGATGGTGCAGGTCAGGGG - Intronic
997228119 5:132224758-132224780 GCCTGGAATGAGCAGGTCAGAGG - Intronic
999309863 5:150545037-150545059 CGCCGGCAGTTGCAGGTCATGGG - Intronic
1001156373 5:169275862-169275884 GCCTGGAAGAGGGAAGTCATGGG + Intronic
1011350948 6:86423276-86423298 GCCTGGAAGATCCAGGTCACTGG + Intergenic
1012284058 6:97366933-97366955 GCCTGGAAGTGGTGGGTCACTGG + Intergenic
1013422363 6:109978430-109978452 TTCTGGAAGTCGCTGGTCATGGG - Exonic
1013602882 6:111721282-111721304 TCCTGGAACTTGCAGTCCATTGG - Intronic
1014103801 6:117540776-117540798 GCCTTGAAGGTGGAGCTCATTGG + Exonic
1015021381 6:128480023-128480045 GTCTGGAAGTTGGAAGTCAAGGG - Intronic
1019064173 6:169282067-169282089 GCCTGGTAGGTGCAGGTCTAAGG - Intergenic
1019135301 6:169904071-169904093 TTCTGGAAGTTGCAGGACAGAGG - Intergenic
1020193994 7:6022965-6022987 GCCTGGGAGATGCAGCTCCTGGG + Exonic
1021906404 7:25338538-25338560 GCCTGGAGTTTTGAGGTCATGGG + Intergenic
1029002220 7:97166369-97166391 GGGTGGGAGTTCCAGGTCATAGG + Intronic
1031150043 7:118043084-118043106 GCCCCGAAGTTGCAGGTTAAAGG - Intergenic
1032477679 7:132223549-132223571 TCCTGGAAGGAGCAGGTCTTGGG + Exonic
1032841565 7:135718008-135718030 GCTTGCAAGTGGCAGCTCATGGG + Intronic
1033012983 7:137642333-137642355 GACTGAAAGTTGCAGCTCCTGGG + Intronic
1033588365 7:142790974-142790996 CCATGGAAGTTGATGGTCATGGG - Intergenic
1034062828 7:148108687-148108709 GGCTGGAAGGTGCAGGGAATGGG + Intronic
1036486412 8:9183509-9183531 GCAGGGAGTTTGCAGGTCATAGG + Intergenic
1037177743 8:15966892-15966914 TGCTGGAAGTTGAAGGTGATTGG - Intergenic
1039823775 8:41156235-41156257 GGCTGGAGGTTGCAGGACCTTGG - Intergenic
1042590568 8:70393874-70393896 GCCTGGACGTTGAAGGGCATTGG - Intronic
1044598551 8:93981332-93981354 ACCCGGGAGCTGCAGGTCATCGG - Intergenic
1044825793 8:96195575-96195597 CATTGGAAGTGGCAGGTCATGGG + Intergenic
1045017155 8:98009903-98009925 TCCTGGAGGTTGGAGGTCAGAGG + Intronic
1045296107 8:100872865-100872887 GCATGGAATTTGCAGGGAATAGG + Intergenic
1047925995 8:129683150-129683172 GCCTGGAAGTTGAAAGACTTGGG - Intergenic
1048832689 8:138491987-138492009 TCGTGTAGGTTGCAGGTCATGGG + Intronic
1049300028 8:141864680-141864702 GCCTGGAAGCTGCAGATCCTGGG - Intergenic
1049335254 8:142080999-142081021 GCCTGGAAGTTTGAAGTCACTGG - Intergenic
1049569293 8:143360918-143360940 GGCAGGAAGTTGCAGGTGCTGGG + Intergenic
1049985220 9:944094-944116 GACTGTAAGTTGGAGGTGATAGG + Intronic
1051356460 9:16243831-16243853 GGCTGGAAGTTGCAGGTGGGAGG - Intronic
1053384757 9:37678186-37678208 GCCTTGAAGCTGGAGGTCATGGG - Intronic
1059656361 9:116361173-116361195 GCATGGAAGCTGAAGGTCACAGG + Intronic
1060789179 9:126474153-126474175 GCATGGAAGGGGCAGGTCAGGGG + Intronic
1062553933 9:137105497-137105519 GCCTCGAAGGTGCTGGGCATGGG + Intronic
1187722320 X:22164023-22164045 GCCTGGAAGTTGCTGGAAAAGGG + Intronic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1197981146 X:132218409-132218431 GGCTGGAGGTTGCAGGTCGGAGG - Intronic