ID: 1160888664

View in Genome Browser
Species Human (GRCh38)
Location 19:1365322-1365344
Sequence GCCTGGAAGTTGCAGGTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160888660_1160888664 9 Left 1160888660 19:1365290-1365312 CCGGGGCAGATTCTCTGCTTCTG No data
Right 1160888664 19:1365322-1365344 GCCTGGAAGTTGCAGGTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160888664 Original CRISPR GCCTGGAAGTTGCAGGTCAT TGG Intronic