ID: 1160890586

View in Genome Browser
Species Human (GRCh38)
Location 19:1376585-1376607
Sequence GGCCCCGCTGACAGCACAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 161}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160890586_1160890595 25 Left 1160890586 19:1376585-1376607 CCGGCTGTGCTGTCAGCGGGGCC 0: 1
1: 0
2: 1
3: 17
4: 161
Right 1160890595 19:1376633-1376655 CATGAGCGTGTCTGAAGATGGGG 0: 1
1: 0
2: 1
3: 9
4: 119
1160890586_1160890594 24 Left 1160890586 19:1376585-1376607 CCGGCTGTGCTGTCAGCGGGGCC 0: 1
1: 0
2: 1
3: 17
4: 161
Right 1160890594 19:1376632-1376654 GCATGAGCGTGTCTGAAGATGGG 0: 1
1: 0
2: 0
3: 16
4: 297
1160890586_1160890596 26 Left 1160890586 19:1376585-1376607 CCGGCTGTGCTGTCAGCGGGGCC 0: 1
1: 0
2: 1
3: 17
4: 161
Right 1160890596 19:1376634-1376656 ATGAGCGTGTCTGAAGATGGGGG 0: 1
1: 0
2: 1
3: 12
4: 123
1160890586_1160890593 23 Left 1160890586 19:1376585-1376607 CCGGCTGTGCTGTCAGCGGGGCC 0: 1
1: 0
2: 1
3: 17
4: 161
Right 1160890593 19:1376631-1376653 TGCATGAGCGTGTCTGAAGATGG 0: 1
1: 0
2: 0
3: 10
4: 136
1160890586_1160890597 27 Left 1160890586 19:1376585-1376607 CCGGCTGTGCTGTCAGCGGGGCC 0: 1
1: 0
2: 1
3: 17
4: 161
Right 1160890597 19:1376635-1376657 TGAGCGTGTCTGAAGATGGGGGG 0: 1
1: 1
2: 0
3: 8
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160890586 Original CRISPR GGCCCCGCTGACAGCACAGC CGG (reversed) Exonic