ID: 1160890590

View in Genome Browser
Species Human (GRCh38)
Location 19:1376606-1376628
Sequence CTGGAGGCGCTTCCACCGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 102}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160890590_1160890596 5 Left 1160890590 19:1376606-1376628 CCTGGCGGTGGAAGCGCCTCCAG 0: 1
1: 0
2: 1
3: 2
4: 102
Right 1160890596 19:1376634-1376656 ATGAGCGTGTCTGAAGATGGGGG 0: 1
1: 0
2: 1
3: 12
4: 123
1160890590_1160890602 30 Left 1160890590 19:1376606-1376628 CCTGGCGGTGGAAGCGCCTCCAG 0: 1
1: 0
2: 1
3: 2
4: 102
Right 1160890602 19:1376659-1376681 TCAGGGGGCACGTTTGCGTTTGG 0: 1
1: 0
2: 0
3: 5
4: 33
1160890590_1160890594 3 Left 1160890590 19:1376606-1376628 CCTGGCGGTGGAAGCGCCTCCAG 0: 1
1: 0
2: 1
3: 2
4: 102
Right 1160890594 19:1376632-1376654 GCATGAGCGTGTCTGAAGATGGG 0: 1
1: 0
2: 0
3: 16
4: 297
1160890590_1160890597 6 Left 1160890590 19:1376606-1376628 CCTGGCGGTGGAAGCGCCTCCAG 0: 1
1: 0
2: 1
3: 2
4: 102
Right 1160890597 19:1376635-1376657 TGAGCGTGTCTGAAGATGGGGGG 0: 1
1: 1
2: 0
3: 8
4: 163
1160890590_1160890601 15 Left 1160890590 19:1376606-1376628 CCTGGCGGTGGAAGCGCCTCCAG 0: 1
1: 0
2: 1
3: 2
4: 102
Right 1160890601 19:1376644-1376666 CTGAAGATGGGGGGCTCAGGGGG 0: 1
1: 1
2: 3
3: 23
4: 304
1160890590_1160890600 14 Left 1160890590 19:1376606-1376628 CCTGGCGGTGGAAGCGCCTCCAG 0: 1
1: 0
2: 1
3: 2
4: 102
Right 1160890600 19:1376643-1376665 TCTGAAGATGGGGGGCTCAGGGG 0: 1
1: 0
2: 6
3: 16
4: 246
1160890590_1160890593 2 Left 1160890590 19:1376606-1376628 CCTGGCGGTGGAAGCGCCTCCAG 0: 1
1: 0
2: 1
3: 2
4: 102
Right 1160890593 19:1376631-1376653 TGCATGAGCGTGTCTGAAGATGG 0: 1
1: 0
2: 0
3: 10
4: 136
1160890590_1160890598 12 Left 1160890590 19:1376606-1376628 CCTGGCGGTGGAAGCGCCTCCAG 0: 1
1: 0
2: 1
3: 2
4: 102
Right 1160890598 19:1376641-1376663 TGTCTGAAGATGGGGGGCTCAGG 0: 1
1: 0
2: 2
3: 35
4: 386
1160890590_1160890595 4 Left 1160890590 19:1376606-1376628 CCTGGCGGTGGAAGCGCCTCCAG 0: 1
1: 0
2: 1
3: 2
4: 102
Right 1160890595 19:1376633-1376655 CATGAGCGTGTCTGAAGATGGGG 0: 1
1: 0
2: 1
3: 9
4: 119
1160890590_1160890599 13 Left 1160890590 19:1376606-1376628 CCTGGCGGTGGAAGCGCCTCCAG 0: 1
1: 0
2: 1
3: 2
4: 102
Right 1160890599 19:1376642-1376664 GTCTGAAGATGGGGGGCTCAGGG 0: 1
1: 0
2: 0
3: 22
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160890590 Original CRISPR CTGGAGGCGCTTCCACCGCC AGG (reversed) Exonic