ID: 1160890595

View in Genome Browser
Species Human (GRCh38)
Location 19:1376633-1376655
Sequence CATGAGCGTGTCTGAAGATG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160890590_1160890595 4 Left 1160890590 19:1376606-1376628 CCTGGCGGTGGAAGCGCCTCCAG 0: 1
1: 0
2: 1
3: 2
4: 102
Right 1160890595 19:1376633-1376655 CATGAGCGTGTCTGAAGATGGGG 0: 1
1: 0
2: 1
3: 9
4: 119
1160890586_1160890595 25 Left 1160890586 19:1376585-1376607 CCGGCTGTGCTGTCAGCGGGGCC 0: 1
1: 0
2: 1
3: 17
4: 161
Right 1160890595 19:1376633-1376655 CATGAGCGTGTCTGAAGATGGGG 0: 1
1: 0
2: 1
3: 9
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160890595 Original CRISPR CATGAGCGTGTCTGAAGATG GGG Exonic