ID: 1160890597

View in Genome Browser
Species Human (GRCh38)
Location 19:1376635-1376657
Sequence TGAGCGTGTCTGAAGATGGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160890586_1160890597 27 Left 1160890586 19:1376585-1376607 CCGGCTGTGCTGTCAGCGGGGCC 0: 1
1: 0
2: 1
3: 17
4: 161
Right 1160890597 19:1376635-1376657 TGAGCGTGTCTGAAGATGGGGGG 0: 1
1: 1
2: 0
3: 8
4: 163
1160890590_1160890597 6 Left 1160890590 19:1376606-1376628 CCTGGCGGTGGAAGCGCCTCCAG 0: 1
1: 0
2: 1
3: 2
4: 102
Right 1160890597 19:1376635-1376657 TGAGCGTGTCTGAAGATGGGGGG 0: 1
1: 1
2: 0
3: 8
4: 163
1160890591_1160890597 -10 Left 1160890591 19:1376622-1376644 CCTCCAGTGTGCATGAGCGTGTC 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1160890597 19:1376635-1376657 TGAGCGTGTCTGAAGATGGGGGG 0: 1
1: 1
2: 0
3: 8
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160890597 Original CRISPR TGAGCGTGTCTGAAGATGGG GGG Exonic