ID: 1160891188

View in Genome Browser
Species Human (GRCh38)
Location 19:1379599-1379621
Sequence ACCACAGATGTCCCCAGACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160891186_1160891188 -6 Left 1160891186 19:1379582-1379604 CCTCTACCATCGAGATGACCACA No data
Right 1160891188 19:1379599-1379621 ACCACAGATGTCCCCAGACGTGG No data
1160891182_1160891188 12 Left 1160891182 19:1379564-1379586 CCATGCCAGGAGCTCCCGCCTCT No data
Right 1160891188 19:1379599-1379621 ACCACAGATGTCCCCAGACGTGG No data
1160891185_1160891188 -3 Left 1160891185 19:1379579-1379601 CCGCCTCTACCATCGAGATGACC No data
Right 1160891188 19:1379599-1379621 ACCACAGATGTCCCCAGACGTGG No data
1160891183_1160891188 7 Left 1160891183 19:1379569-1379591 CCAGGAGCTCCCGCCTCTACCAT No data
Right 1160891188 19:1379599-1379621 ACCACAGATGTCCCCAGACGTGG No data
1160891184_1160891188 -2 Left 1160891184 19:1379578-1379600 CCCGCCTCTACCATCGAGATGAC No data
Right 1160891188 19:1379599-1379621 ACCACAGATGTCCCCAGACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160891188 Original CRISPR ACCACAGATGTCCCCAGACG TGG Intergenic
No off target data available for this crispr