ID: 1160892855

View in Genome Browser
Species Human (GRCh38)
Location 19:1388326-1388348
Sequence ATTCAAGTCTGGGCCATCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160892851_1160892855 6 Left 1160892851 19:1388297-1388319 CCTGCTGGGTACGTCACAAAAGA 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1160892855 19:1388326-1388348 ATTCAAGTCTGGGCCATCATTGG 0: 1
1: 0
2: 1
3: 6
4: 113
1160892847_1160892855 30 Left 1160892847 19:1388273-1388295 CCGTCCTTGCTTGGACACTGTTG 0: 1
1: 0
2: 0
3: 30
4: 193
Right 1160892855 19:1388326-1388348 ATTCAAGTCTGGGCCATCATTGG 0: 1
1: 0
2: 1
3: 6
4: 113
1160892848_1160892855 26 Left 1160892848 19:1388277-1388299 CCTTGCTTGGACACTGTTGACCT 0: 1
1: 0
2: 1
3: 10
4: 134
Right 1160892855 19:1388326-1388348 ATTCAAGTCTGGGCCATCATTGG 0: 1
1: 0
2: 1
3: 6
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160892855 Original CRISPR ATTCAAGTCTGGGCCATCAT TGG Intronic
908278887 1:62507718-62507740 ATGCAAGACTAGGCCATCAAGGG + Intronic
911816348 1:102357471-102357493 ATTCAAGGCTGGTTCAACATGGG + Intergenic
912618724 1:111133499-111133521 ATTCACCTCTGGGCCATGCTTGG + Intronic
914339677 1:146749210-146749232 CGTCAAGTCTGGGACATCTTAGG - Intergenic
915461279 1:156071969-156071991 ATGTAAGTCTGTGCCATCTTGGG - Intergenic
920842332 1:209565256-209565278 ACTCAAATCTGGGTCATCCTTGG + Intergenic
922587525 1:226746154-226746176 ATTTCAGGCTGGGCCATCAGAGG - Intergenic
1064703832 10:18049943-18049965 ATGCAAAACTGGGCCATCCTAGG - Intergenic
1065493880 10:26309453-26309475 AAACTAGTCTGGGCCATGATGGG - Intergenic
1066514017 10:36135317-36135339 ATTAAAATCTGTGCCATCATTGG - Intergenic
1066699235 10:38109161-38109183 ATGCAAGGCTGGTGCATCATAGG + Intronic
1067020834 10:42795961-42795983 AGCCAAATCTGGGCCAGCATAGG - Intronic
1073671181 10:105591840-105591862 TTTCAAGTCTGGGTCATGAATGG + Intergenic
1075216202 10:120538356-120538378 AGCCAAGTCTGTGCCATCTTTGG + Intronic
1076737177 10:132464135-132464157 ATTCAAGGCTGGGGCATCTCCGG - Intergenic
1078017759 11:7629868-7629890 AATCAACTCAGTGCCATCATTGG + Intronic
1078131184 11:8615432-8615454 CTTCAAAACTGGGCCATTATGGG + Exonic
1078223269 11:9369515-9369537 TTTCACATCTGGGCCATCTTGGG - Intergenic
1080716731 11:34809667-34809689 AATCAAGTCTTGGCCATTTTGGG + Intergenic
1083581430 11:63827718-63827740 AGTTCCGTCTGGGCCATCATTGG + Exonic
1084440208 11:69168364-69168386 ATTCAAGCCCAGGCCATCGTTGG - Intergenic
1087442380 11:98202737-98202759 ATACAAGTCTGGTTCAACATAGG + Intergenic
1087832901 11:102838686-102838708 AATCAATTCTGGGCTATCAGAGG - Exonic
1090900882 11:131030017-131030039 ATTCACGTCTGGTCGATCAGTGG - Intergenic
1091913554 12:4251041-4251063 ATTCCACTCTGGGCCATCGCGGG + Intergenic
1093563511 12:20573441-20573463 ATTCAAGTCTGTCTCTTCATAGG - Intronic
1098079632 12:66770466-66770488 ATTCAGGTCTTGCACATCATGGG + Intronic
1098689680 12:73471547-73471569 ATTCAAGTCTGTGCATTTATGGG + Intergenic
1099870270 12:88339575-88339597 ATTCAAGTCTTCTACATCATTGG + Intergenic
1108248866 13:48544993-48545015 ATTCCAGTCTGAGCCAACTTGGG + Intergenic
1109908043 13:68871704-68871726 ATTCAACTGTAGGCCATCAATGG + Intergenic
1111063678 13:83060489-83060511 ATTGAAGTCAGGACAATCATTGG - Intergenic
1114700441 14:24672829-24672851 ATTCTAATATGGGCCATCTTGGG + Intergenic
1115421748 14:33203153-33203175 ATTAAAATCTGTGCCATCATTGG - Intronic
1118231236 14:63951971-63951993 ATCCTAGTTTTGGCCATCATTGG + Intronic
1118600907 14:67470975-67470997 ATTGAAGTCTGGGCTATCCCTGG + Exonic
1202855892 14_GL000225v1_random:52151-52173 ATTCCCGTGTGCGCCATCATGGG - Intergenic
1124665582 15:31588939-31588961 CTTCTAGGCTGGCCCATCATAGG - Intronic
1125452008 15:39818695-39818717 AGTCAAGTCTGCCCCATCCTTGG + Intronic
1125673460 15:41489727-41489749 GTTCAAGACTTGGCCAACATAGG + Intergenic
1126773614 15:52081003-52081025 ATTCTAGTCTGGGGCAGCAAAGG + Intergenic
1128085498 15:64883723-64883745 ATTCAAGTGTGGGCTCTGATTGG - Intronic
1128502232 15:68234577-68234599 ATTCAGCTCTGGGCTGTCATGGG - Intronic
1131714425 15:95092870-95092892 ATTCAAATTTGGGCCACCTTGGG + Intergenic
1136479180 16:30531037-30531059 CTTTAAGTATGTGCCATCATGGG - Intronic
1136607534 16:31346599-31346621 GTTCAAGTCTGCGCCAAGATGGG - Intergenic
1139994609 16:70968198-70968220 CGTCAAGTCTGGGACATCTTAGG + Intronic
1140819137 16:78647076-78647098 CCTCAAGGCTTGGCCATCATCGG - Intronic
1141000826 16:80306272-80306294 ATTGAATTCTGGACCATGATGGG + Intergenic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1153242680 18:3044985-3045007 ATCCAAATCTGGGCCATCTGTGG - Intergenic
1158622037 18:59041176-59041198 GGTCATGTCTGGGCCATCAGTGG + Intergenic
1160892855 19:1388326-1388348 ATTCAAGTCTGGGCCATCATTGG + Intronic
1162553995 19:11375164-11375186 ATTGAAGTCCGGCCCATCAAGGG + Intronic
1163137515 19:15323359-15323381 ATGCCAGTCTGGGCCATACTGGG - Intronic
926399900 2:12486724-12486746 ATTCCAGTCTGACTCATCATGGG + Intergenic
936609272 2:113985886-113985908 ATTTAATTCTGGGCCATTGTGGG + Intergenic
937547995 2:123048368-123048390 TTTCAAGTCTAGGTCATAATGGG - Intergenic
940714173 2:157200371-157200393 ATTCAAATATGGATCATCATAGG + Intergenic
941100526 2:161290006-161290028 ATGCAAGGCTGGTCCAACATAGG + Intergenic
942178411 2:173355978-173356000 GTTCAAATCTGAGCCACCATGGG + Intronic
944369130 2:198961134-198961156 CTTAAAGACTGGGCTATCATGGG - Intergenic
944663970 2:201943990-201944012 GTTCAAATCTGTGCCATCAAGGG + Intergenic
1172181920 20:33008773-33008795 ATTAAAATCTGGGTCCTCATGGG - Intronic
1174714782 20:52746146-52746168 ATTCAAAGCTGCCCCATCATAGG - Intergenic
1180864211 22:19106555-19106577 TTTGAACTCTGGGCCCTCATGGG - Intronic
1180964723 22:19781367-19781389 ATTCAAAAATGGGCCATCCTGGG - Intronic
1184790125 22:46695046-46695068 ATGCACGCCTAGGCCATCATGGG + Intronic
955354935 3:58223424-58223446 ATTCAACTCTGGGCCCTCAAGGG - Intergenic
955921884 3:63965655-63965677 ATTAACGTCTGAGCCATCATTGG + Intronic
955941121 3:64147659-64147681 ATGCCAGTGTTGGCCATCATAGG + Exonic
959843232 3:111002425-111002447 ATGCAAGTCTGGTTCAACATAGG + Intergenic
963256295 3:143148026-143148048 GTTTAAGATTGGGCCATCATTGG - Intergenic
967737462 3:192968172-192968194 ATGCAAGTCTGGTTCAACATAGG - Intergenic
971276701 4:25205245-25205267 AATCAAGTCTTGGCCATTTTGGG - Intronic
971769060 4:30872570-30872592 ATTCAAATTTTGACCATCATTGG + Intronic
972453468 4:39228659-39228681 ATTAAATTCTGTGCCAGCATTGG - Exonic
973531204 4:51838579-51838601 ATACCAGTCTGGGCCAACACAGG - Intergenic
974410342 4:61533143-61533165 ATTTAATTCTGGGTCTTCATTGG - Intronic
975429701 4:74274301-74274323 ATTCAAATCTGGTCAATCAAAGG + Intronic
977496523 4:97781760-97781782 ATGCAAGTCTGGTTCAACATAGG + Intronic
977497579 4:97797501-97797523 ATGCAAGTCTGGTTCAACATAGG - Intronic
978342668 4:107734769-107734791 TTTAAGGTCTGGGCTATCATTGG - Intergenic
979487291 4:121283655-121283677 CTTCATGTCTGGGGCACCATGGG - Intergenic
982573906 4:157084361-157084383 ATACAAGTATGGGCCAAAATGGG - Intronic
985945168 5:3176835-3176857 ATTCATGTCTGGCCCTTCACAGG - Intergenic
993835233 5:92811770-92811792 ATTCAAGCCTGACCCTTCATGGG + Intergenic
999472556 5:151868583-151868605 ATTCATATCTGGGATATCATGGG - Intronic
1000626439 5:163544797-163544819 ATTCAAGTGATGGACATCATAGG + Intergenic
1002406612 5:179038833-179038855 TTTCTAGTCTGGCCCTTCATTGG + Intergenic
1002590113 5:180285264-180285286 ATTCAAATCTGAGCCATGCTGGG - Intronic
1003739764 6:8923075-8923097 GTTCAAATCTTGACCATCATTGG - Intergenic
1007748432 6:44057230-44057252 ATTCCAGGCTGGGCCATGCTGGG + Intergenic
1010352331 6:74888957-74888979 ACTCAAGTCTGGGCAATGGTGGG + Intergenic
1012034638 6:94118213-94118235 ATTCTAGTCTCTGCCATGATAGG + Intergenic
1012600589 6:101092136-101092158 CTTCAAGTGTTGGCCATGATAGG + Intergenic
1014492159 6:122075855-122075877 ATTCAAATTAGGGCCATCAGAGG + Intergenic
1014679352 6:124409507-124409529 ATGCAAGGCTGGTCCAACATAGG - Intronic
1019568890 7:1699207-1699229 TTTCTAGTCTGGGCTATCGTGGG + Intronic
1021700756 7:23317281-23317303 ATTCAAGTCTAGGCAATCTCAGG + Intronic
1024988787 7:55218939-55218961 ATCCAAGTCTCAGCCATGATGGG + Intronic
1026519799 7:71106781-71106803 TCTCTACTCTGGGCCATCATGGG - Intergenic
1033013760 7:137650677-137650699 ATTCTAGTGAGGGCCATCTTTGG - Intronic
1033451967 7:141470296-141470318 GTCCAAGACTGGGCCATTATTGG + Intronic
1045182635 8:99802115-99802137 ACTCAAGTCTGGGCAATAAAGGG + Intronic
1046528781 8:115417150-115417172 ATTGAAGTCTGGCCAATCATAGG - Intronic
1047609711 8:126509109-126509131 ATTTAAGTCAGGGCCTTCTTAGG + Intergenic
1048217367 8:132508684-132508706 ATTAAAGTCTGGGCCATGATAGG - Intergenic
1050220660 9:3385739-3385761 ATTCAACTCTGGGACGTCCTTGG + Intronic
1055517260 9:77045842-77045864 AATCAAGCCTGGGTCAACATAGG - Intergenic
1059560786 9:115332827-115332849 ACTCTAGTCTGGGCCTTCACTGG - Intronic
1203372232 Un_KI270442v1:318695-318717 ATGAAAGTTTGGTCCATCATGGG + Intergenic
1190588343 X:51970140-51970162 ATTCAAGTATGAGTCTTCATAGG + Intergenic
1191070374 X:56394416-56394438 ATTCAAGCCTGGGCAATGGTGGG + Intergenic
1192755482 X:74042895-74042917 ATGCAAGTCTGGTTCAACATAGG - Intergenic
1193029540 X:76882652-76882674 AATCAAGCCTGGGCAATCACAGG - Intergenic
1195533296 X:105982276-105982298 ATTGCAGTCTGAGCCATGATAGG - Intergenic
1196158741 X:112459325-112459347 AATGAAGTTTGGGCCATCATAGG - Intergenic
1197728348 X:129791318-129791340 GTTCAAGACTGGGTCATCTTGGG - Intronic
1198477156 X:137006324-137006346 ATGCAAGTCTGGTTCAACATAGG + Intergenic
1201338718 Y:12907991-12908013 ATTCATTTCTGGCCCAGCATGGG + Intronic