ID: 1160894751

View in Genome Browser
Species Human (GRCh38)
Location 19:1397182-1397204
Sequence GCTGCTGGTGACACACAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 759
Summary {0: 1, 1: 1, 2: 1, 3: 35, 4: 721}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160894748_1160894751 -2 Left 1160894748 19:1397161-1397183 CCTCACAGAGAAGCTGGGAAAGC 0: 1
1: 1
2: 1
3: 34
4: 333
Right 1160894751 19:1397182-1397204 GCTGCTGGTGACACACAGCTGGG 0: 1
1: 1
2: 1
3: 35
4: 721
1160894744_1160894751 19 Left 1160894744 19:1397140-1397162 CCTGCAGTGGGCAGCAGTGACCC 0: 1
1: 0
2: 6
3: 57
4: 341
Right 1160894751 19:1397182-1397204 GCTGCTGGTGACACACAGCTGGG 0: 1
1: 1
2: 1
3: 35
4: 721
1160894743_1160894751 20 Left 1160894743 19:1397139-1397161 CCCTGCAGTGGGCAGCAGTGACC 0: 1
1: 0
2: 4
3: 29
4: 254
Right 1160894751 19:1397182-1397204 GCTGCTGGTGACACACAGCTGGG 0: 1
1: 1
2: 1
3: 35
4: 721
1160894747_1160894751 -1 Left 1160894747 19:1397160-1397182 CCCTCACAGAGAAGCTGGGAAAG 0: 1
1: 1
2: 1
3: 37
4: 345
Right 1160894751 19:1397182-1397204 GCTGCTGGTGACACACAGCTGGG 0: 1
1: 1
2: 1
3: 35
4: 721
1160894742_1160894751 29 Left 1160894742 19:1397130-1397152 CCTCAGGGACCCTGCAGTGGGCA 0: 1
1: 1
2: 9
3: 40
4: 327
Right 1160894751 19:1397182-1397204 GCTGCTGGTGACACACAGCTGGG 0: 1
1: 1
2: 1
3: 35
4: 721

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160894751 Original CRISPR GCTGCTGGTGACACACAGCT GGG Intronic
900090911 1:920123-920145 GCTCCTGCAGACACACAGGTGGG - Intergenic
900251485 1:1672600-1672622 GCTGCTGTTGACATGCAGCTGGG + Intronic
900699999 1:4040924-4040946 GATGATGGTGACATACAGATGGG - Intergenic
900818137 1:4866243-4866265 GATGATGGTGACATACAGATGGG + Intergenic
901236958 1:7672313-7672335 GGTGGTGGTGGCAGACAGCTGGG - Intronic
903046928 1:20571529-20571551 GCTGCTGCTGAAAGTCAGCTGGG - Intergenic
903159665 1:21477431-21477453 GATGCTGGTGACCTACAGATGGG + Intronic
903929775 1:26855510-26855532 GCTAGTGGTCACAGACAGCTGGG + Exonic
904654662 1:32035324-32035346 GCTGCTTGAGACTCACACCTTGG - Intronic
904898374 1:33836013-33836035 GATGATGGTGACATACAGATGGG + Intronic
905395483 1:37663837-37663859 GCTGCTGGGGTCACACTGCCTGG - Intergenic
905990631 1:42334810-42334832 GCTGCTGCTGCCCCTCAGCTGGG - Intronic
907408866 1:54270893-54270915 GCCTCTGGTGTCACACAGCCTGG - Intronic
907434866 1:54438971-54438993 GGTGCTTGTGAGACAGAGCTGGG - Intergenic
908595527 1:65685323-65685345 GATGATGGTGACATACAGATGGG + Intergenic
909274603 1:73667668-73667690 GATGATGGTGACATACAGATGGG + Intergenic
909307201 1:74096698-74096720 GATGATGGTGACATACAGATGGG + Intronic
909557526 1:76970037-76970059 GATGTTGGTGACATACAGATGGG - Intronic
910381634 1:86633109-86633131 GATGATGGTGACATACAGATGGG + Intergenic
911106383 1:94135092-94135114 GATGATGGTGACAAACAGATGGG - Intergenic
911213088 1:95163657-95163679 GATGATGGTGACATACAGATGGG + Intronic
911339180 1:96617018-96617040 GATGGTGGTGACATACAGATGGG + Intergenic
911717241 1:101147208-101147230 GCTGATGGTGACACATATCTGGG + Intergenic
912463323 1:109852054-109852076 GATGCTGGTGACCCACAGATGGG - Intergenic
913285095 1:117218571-117218593 GATGATGGTGACATACAGATGGG - Intergenic
913407938 1:118516931-118516953 GATGATGGTGACCCACAGATGGG + Intergenic
913710520 1:121478100-121478122 GATGATGGTGACATACAGATGGG - Intergenic
914226090 1:145720820-145720842 TGTGCTGGTCACACAAAGCTTGG + Intronic
914683369 1:149957190-149957212 GATGATGGTGACATACAGATGGG + Intronic
915644135 1:157254916-157254938 GATGATGGTGACATACAGATAGG - Intergenic
915760317 1:158304928-158304950 GATGATGGTGACATACAGATGGG - Intergenic
915960248 1:160260822-160260844 GCTGCTTGTGACTAAAAGCTGGG - Intronic
918240318 1:182615057-182615079 GCTGATGGTGCCACAGAGCCCGG - Intergenic
918593052 1:186261741-186261763 GATGATGGTGACATACAGATGGG + Intergenic
918968139 1:191377942-191377964 GATGCTGGTGACCTACAGGTGGG + Intergenic
919810487 1:201405989-201406011 GATGCAGGTGACATACAGATGGG - Exonic
919886494 1:201938775-201938797 GATGCTGTTTACAAACAGCTAGG - Intronic
920064509 1:203257464-203257486 GATGCTGGTGACCTACAGATGGG - Intronic
920264597 1:204712331-204712353 GCAGCTGCTGACAGACAGCTGGG + Intergenic
920589962 1:207207710-207207732 GATGATGGTGACAAACAGATGGG - Intergenic
920632108 1:207662797-207662819 GATGATGGTGACATACAGATAGG + Intronic
920651220 1:207838787-207838809 CCTGTTGGGAACACACAGCTGGG - Intergenic
922141564 1:222893520-222893542 GCTGCTGTGCACAGACAGCTAGG + Intronic
922903367 1:229155642-229155664 GCTGTGGCTGACACACAGCATGG + Intergenic
923340786 1:233005359-233005381 GCTGCCGGGCACACGCAGCTGGG - Intronic
924285534 1:242482050-242482072 GATGATGGTGACATACAGATGGG - Intronic
1064397620 10:14994064-14994086 GCTGCAGCTGACAAACAGGTAGG + Intergenic
1064829417 10:19445465-19445487 GATGATGGTGACATACAGATGGG + Intronic
1065237766 10:23671580-23671602 GATGATGGTGACATACAGATGGG + Intergenic
1065606120 10:27419238-27419260 GATGATGGTGACATACAGATGGG - Intergenic
1065845274 10:29737996-29738018 GATGTAGGTGACACACATCTTGG - Intergenic
1065944895 10:30597337-30597359 CCTGCTGGTTACACTGAGCTGGG - Intergenic
1066060378 10:31718826-31718848 GATGATGGTGACATACAGATGGG + Intergenic
1066146105 10:32559663-32559685 GATGATGGTGACATACAGATGGG - Intronic
1066163084 10:32755590-32755612 GATGTTGGTGACATACAGATGGG - Intronic
1066190765 10:33053627-33053649 CCTGCTGGAGACACAGAGCAAGG - Intergenic
1066274199 10:33852896-33852918 GATGATGGTGACACATAGGTGGG + Intergenic
1067199149 10:44151554-44151576 GATGATGGTGACATACAGATGGG + Intergenic
1067955577 10:50787593-50787615 GATGATGGTGACATACAGATGGG + Intronic
1068239731 10:54289380-54289402 GATGTTGGTGACCCACAGATGGG - Intronic
1068940574 10:62677361-62677383 GATGATGGTGACATACAGATTGG + Intergenic
1069057162 10:63856843-63856865 GATGATGGTGACATACAGATGGG + Intergenic
1070003172 10:72396270-72396292 GATGTTGGTGACCTACAGCTGGG - Intronic
1070343555 10:75520838-75520860 GCTGTTGGTGACCTACAGATGGG + Intronic
1071211056 10:83342529-83342551 GATGATGGTGACATACAGATGGG + Intergenic
1071489716 10:86128086-86128108 GCTGCTGGTGGCACAGAGGAAGG - Intronic
1071825068 10:89317049-89317071 GATGATGGTGACATACAGATGGG - Intronic
1071900698 10:90118213-90118235 GCTGATGGTGACGTACAGATGGG + Intergenic
1072243748 10:93521936-93521958 GATGATGGTGACATACAGATGGG - Intronic
1072388694 10:94959777-94959799 GATGATGGTGACATACAGATGGG + Intronic
1072760925 10:98055985-98056007 TCTGCAGCTGACACAAAGCTGGG - Intergenic
1072869301 10:99099983-99100005 GATGATGGTGACATACAGATGGG - Intronic
1074464921 10:113672392-113672414 GATGATGGTGACATACAGATGGG - Intergenic
1074776020 10:116768932-116768954 GCAGAGGGTGACACACAGCAGGG - Intergenic
1075739257 10:124683895-124683917 GCTGCTTGTGACGCTCAGCTGGG - Intronic
1076016347 10:127030375-127030397 GTGGCTGGTGACAGACAGCGAGG - Intronic
1076768101 10:132647775-132647797 GCTGCTTATGACACAAAGCAGGG - Intronic
1076938356 10:133581539-133581561 GATGATGGTGACATACAGATGGG - Intergenic
1077435136 11:2535295-2535317 GCAGCTGGGGACACCCAGGTGGG + Intronic
1078695553 11:13628237-13628259 GATGATGGTGACATACAGATGGG + Intergenic
1079037465 11:17033652-17033674 GATGATGGTGACATACAGATTGG + Intergenic
1080490971 11:32763605-32763627 GATGATGGTGACATACAGATGGG - Intronic
1081087579 11:38821429-38821451 GATGATGGTGACATACAGATGGG + Intergenic
1081180950 11:39985024-39985046 GATGATGGTGACATACAGATGGG - Intergenic
1081500112 11:43658543-43658565 GATGATGGTGACATACAGATGGG + Intronic
1081847661 11:46252311-46252333 CTTGCTGGTGTCACACAGGTAGG - Intergenic
1082123309 11:48403315-48403337 GATGATGGTGACATACAGATGGG - Intergenic
1082575530 11:54798592-54798614 GATGATGGTGACATACAGATGGG - Intergenic
1082619028 11:55398414-55398436 GATGATGGTGACATACAGATGGG + Intergenic
1082647687 11:55748409-55748431 GATGATGGTGACATACAGATGGG - Intergenic
1082744548 11:56948010-56948032 GATGATGGTGACATACAGATGGG + Intergenic
1082905982 11:58309288-58309310 GATGATGGTGACATACAGATGGG + Intergenic
1082956545 11:58876439-58876461 GATGATGGTGACATACAGATGGG + Intronic
1083509406 11:63193647-63193669 GATGATGGTGACATACAGATGGG - Intronic
1083522952 11:63333280-63333302 GATGATGGTGACATACAGATGGG + Intronic
1083530799 11:63419695-63419717 GATGATGGTGACATACAGATGGG - Intergenic
1083531962 11:63431280-63431302 GATGATGGTGACATACAGATGGG - Intergenic
1084214354 11:67639493-67639515 GCTCCTGGAGAAACACTGCTTGG + Exonic
1084228103 11:67730040-67730062 GCTGCAGCTGACAAACAGGTTGG + Intergenic
1084844208 11:71886834-71886856 GCTGCAGCTGACAAACAGGTCGG - Intronic
1084847063 11:71909292-71909314 GCTGCAGCTGACAAACAGGTCGG - Intronic
1085435102 11:76493167-76493189 GGTGCTGTTGCCACCCAGCTGGG + Intronic
1086691369 11:89790740-89790762 GATGCTGGTGACGTACAGATGGG - Intergenic
1086714434 11:90048916-90048938 GATGCTGGTGACGTACAGATGGG + Intergenic
1086824246 11:91475653-91475675 GGTGCTGGTGACACCGAGGTGGG - Intergenic
1086874040 11:92073511-92073533 GATGCTGGTGACGTACAGATGGG - Intergenic
1087177365 11:95108011-95108033 GCTGCTCATCACACACAGCGAGG - Intronic
1087249051 11:95875750-95875772 GATGATGGTGACATACAGATGGG + Intronic
1087616298 11:100489675-100489697 GATGATGGTGACATACAGATGGG - Intergenic
1088309192 11:108441808-108441830 GATGATGGTGACATACAGATGGG - Intronic
1089106047 11:116005893-116005915 GATGATGGTGACATACAGATGGG - Intergenic
1089192940 11:116667737-116667759 GATGATGGTGACCCACAGATGGG - Intergenic
1089707463 11:120290078-120290100 GCTGCTGTTGAAACAGACCTCGG + Intronic
1089888580 11:121855876-121855898 GCTGATGGTGACGTACAGATGGG - Intergenic
1090322384 11:125858326-125858348 GATGATGGTGACATACAGATGGG - Intergenic
1091246700 11:134102355-134102377 GATGATGGTGACATACAGATGGG - Intronic
1091684537 12:2552225-2552247 GGTGGTGGTGACACACAACAGGG + Intronic
1091800487 12:3321652-3321674 GCTGCTGGTGAGAGGCAGCAGGG + Intergenic
1091846833 12:3662717-3662739 GCTCCTGCTCACACACAGCCTGG - Intronic
1092562587 12:9632424-9632446 GATGATGGGGACACACAGATGGG + Intergenic
1092772511 12:11910140-11910162 GATGCTGGTGACATACAGATAGG - Intergenic
1093217608 12:16382288-16382310 GATGATGGTGACATACAGATGGG + Intronic
1093314141 12:17627677-17627699 GATGATGGTGACATACAGATGGG + Intergenic
1093802406 12:23389673-23389695 GATGATGGTGACATACAGATGGG - Intergenic
1094301279 12:28967478-28967500 GCTGCTGTTGACAGATTGCTGGG - Intergenic
1094311915 12:29093341-29093363 GATGCTGGTGACCTACAGTTGGG - Intergenic
1094333679 12:29323738-29323760 GATGATGGTGACATACAGATGGG - Intronic
1094451737 12:30589338-30589360 GATGATGGTGACATACAGATGGG - Intergenic
1094728401 12:33146926-33146948 GATGATGGTGACATACAGATGGG + Intergenic
1094791430 12:33920058-33920080 GATGTTGGTGACATACAGATGGG + Intergenic
1094861256 12:34469198-34469220 GATGATGGTGACATACAGATGGG + Intergenic
1094875741 12:34640512-34640534 GATGATGGTGACATACAGATGGG - Intergenic
1096036471 12:48475238-48475260 GATGATGGTGACATACAGATGGG - Intergenic
1096954274 12:55509852-55509874 GATGATGGTGACATACAGATGGG + Intergenic
1096963006 12:55599054-55599076 GATGATGGTGACATACAGATGGG - Intergenic
1098015439 12:66099880-66099902 GATGATGGTGACATACAGATGGG + Intergenic
1098097828 12:66978975-66978997 GCTGCTGGAGGCATAAAGCTTGG - Intergenic
1098699532 12:73606682-73606704 GATGATGGTGACATACAGATAGG - Intergenic
1098722915 12:73925122-73925144 GATGATGGTGACATACAGATGGG - Intergenic
1099313855 12:81061395-81061417 GATGATGGTGACATACAGATGGG + Intronic
1099764974 12:86971369-86971391 GATGATGGTGACATACAGATGGG - Intergenic
1099791692 12:87343389-87343411 GCTCCTGTTGAGGCACAGCTGGG + Intergenic
1101243008 12:102856824-102856846 GATGATGGTGACACACAGATGGG - Intronic
1101401669 12:104393708-104393730 GATGATGGTGACATACAGATGGG + Intergenic
1102083766 12:110119378-110119400 GCTTCTGGTGAGAAACAGATTGG + Intergenic
1102199143 12:111045362-111045384 GCAGCTTGGGACACATAGCTGGG - Intronic
1104090719 12:125514819-125514841 GGTCCTGGGGACACACTGCTGGG + Intronic
1104403431 12:128496982-128497004 GATGATGGTGACATACAGATGGG + Intronic
1104636721 12:130442179-130442201 CCTGCTGGTGACGCACTGCACGG + Exonic
1104960689 12:132487376-132487398 GCTCCCGGAGACACACAGCCCGG + Intergenic
1105311774 13:19218716-19218738 GATGATGGTGACATACAGATGGG + Intergenic
1105351077 13:19616889-19616911 GATGATGGTGACATACAGATGGG + Intergenic
1105489508 13:20874111-20874133 ACTGCTGGCGACACACAGTTGGG + Intronic
1105632689 13:22186776-22186798 GCTGATGGTGACACATAGAAAGG + Intergenic
1105701043 13:22935846-22935868 GCTGCAGGTGGCAGACACCTGGG - Intergenic
1105853873 13:24358894-24358916 GCTGCAGGTGGCAGACACCTGGG - Intergenic
1105992699 13:25638098-25638120 GATGATGGTGACATACAGATGGG - Intronic
1106617356 13:31341561-31341583 GATGATGGTGACATACAGATGGG - Intergenic
1106784029 13:33089486-33089508 GCTCCTGTGGGCACACAGCTGGG - Intergenic
1108892403 13:55277727-55277749 GATGATGGTGACATACAGATGGG + Intergenic
1109322867 13:60832349-60832371 GATGATGGTGACATACAGATGGG + Intergenic
1110001590 13:70209697-70209719 GATGATGGTGACATACAGATGGG - Intergenic
1110502445 13:76243831-76243853 GGTGATGGTGACATACAGATGGG - Intergenic
1111273447 13:85916935-85916957 GATGATGGTGACATACAGATGGG + Intergenic
1113021202 13:105889532-105889554 GATGATGGTGACATACAGATGGG + Intergenic
1113422941 13:110184059-110184081 GCTGTTGGTGACACACACCCTGG + Intronic
1113457044 13:110456762-110456784 GATGCTGGTGCCTCACAACTGGG + Intronic
1113488188 13:110670545-110670567 GATGGTGGTGACATACAGATGGG - Intronic
1113591004 13:111501274-111501296 GTTGATGGTGACATACAGATGGG + Intergenic
1113867198 13:113534676-113534698 GCTGCTGGAGAGACTGAGCTGGG + Intronic
1113987300 13:114328333-114328355 GCTGCAGAGGAAACACAGCTGGG - Intergenic
1114170047 14:20263021-20263043 GGGGCTGCTGACACACAGCCAGG + Intronic
1114406761 14:22464028-22464050 GCTGCTGCTGACACCCAGCCAGG - Intergenic
1114579424 14:23744075-23744097 GATGATGGTGACATACAGATGGG + Intergenic
1114599584 14:23943428-23943450 GGTGTTGGTGACATACAGATGGG - Intergenic
1114765791 14:25369689-25369711 GATGATGGTGACATACAGATTGG + Intergenic
1115717601 14:36123578-36123600 GATGATGGTGACATACAGATGGG + Intergenic
1115802004 14:37005013-37005035 GCTGGTTGAGACCCACAGCTGGG - Intronic
1115827566 14:37294300-37294322 GATGATGGTGACATACAGATGGG - Intronic
1116402982 14:44531810-44531832 GCTGCTGATGACAAGCAGATTGG + Intergenic
1116431787 14:44854404-44854426 GATGATGGTGACATACAGATGGG - Intergenic
1116482863 14:45412387-45412409 GATGCTGGTGACCTACAGATGGG - Intergenic
1117260923 14:54032852-54032874 GATGATGGTGACATACAGATGGG + Intergenic
1117285616 14:54283121-54283143 GCAGCTGGGGAGGCACAGCTGGG - Intergenic
1117891450 14:60426629-60426651 GATGATGGTGACATACAGATGGG + Intronic
1118415122 14:65527699-65527721 GATGATGGTGACATACAGATGGG + Intronic
1119699719 14:76745254-76745276 GATGATGGTGACATACAGATGGG - Intergenic
1119727847 14:76932965-76932987 TCTCCTGCTGACACCCAGCTCGG - Intergenic
1119888667 14:78165830-78165852 ACTGCTGTTGACTCACTGCTGGG + Intergenic
1120478831 14:85023542-85023564 GATGATGGTGACATACAGATGGG + Intergenic
1120709671 14:87780602-87780624 GATGATGGTGACATACAGATGGG + Intergenic
1121598299 14:95183148-95183170 TCTGCAGGTGAGCCACAGCTAGG + Exonic
1122252791 14:100451932-100451954 TCTGCTGATGACCCAAAGCTAGG + Intronic
1122443260 14:101749359-101749381 GATGCTGGTGACCTACAGATGGG + Intergenic
1123035117 14:105468838-105468860 GCTCCTGGTCACCCCCAGCTGGG - Intronic
1202846560 14_GL000009v2_random:182983-183005 GATGATGGTGACATACAGATGGG + Intergenic
1202876735 14_KI270722v1_random:9458-9480 GATGATGGTGACATACAGATGGG - Intergenic
1202918928 14_KI270723v1_random:12960-12982 GATGAATGTGACACACAGCTAGG - Intergenic
1202925701 14_KI270724v1_random:22032-22054 GATGAATGTGACACACAGCTAGG + Intergenic
1123877522 15:24639082-24639104 GATGATGGTGACATACAGATGGG + Intergenic
1124402690 15:29363946-29363968 GCTTTTGGTGCCACACACCTGGG + Intronic
1124561343 15:30776130-30776152 GATGATGGTGACATACAGATGGG - Intergenic
1124561353 15:30776236-30776258 GATGATGGTGACATACAGATGGG - Intergenic
1124863975 15:33471291-33471313 GGCTCTGGTGACACACAGATGGG - Intronic
1124885796 15:33684479-33684501 GATGCTGGTGACCTACAGATGGG - Intronic
1124918142 15:33996690-33996712 GATGCTGGTGACCTACAGATGGG - Intronic
1125449556 15:39794247-39794269 GCTGTTGGTGCCACACTGCTGGG - Intergenic
1126086960 15:45020237-45020259 GATGCTGGTGACCTACAGATGGG + Intergenic
1126709796 15:51443353-51443375 GCTGCTGGTGCCAGCCAGCCAGG + Intergenic
1126889066 15:53184215-53184237 GATGATGGTGACATACAGATGGG - Intergenic
1127021186 15:54750229-54750251 GATGATGGTGACATACAGATGGG - Intergenic
1127057238 15:55144156-55144178 GGTGATGGTGACATACAGGTGGG - Intergenic
1127355453 15:58194378-58194400 GATGATGGTGACATACAGATGGG - Intronic
1128228136 15:66017073-66017095 GCTGCTGGAGAAGCACAGCCCGG + Intronic
1128677440 15:69622170-69622192 GATGATGGTGACATACAGATGGG + Intergenic
1129129645 15:73482006-73482028 GCTGCTGGTGGCACAATGATAGG - Intronic
1129631075 15:77261113-77261135 GATGATGGTGACATACAGATGGG - Intronic
1130064657 15:80593822-80593844 GCGCCTGGGGACACACAGCGGGG - Exonic
1130223385 15:82040101-82040123 GCTGCTGGTAACAGAGACCTGGG + Intergenic
1130452703 15:84073057-84073079 GATGCTGGTGACCTACAGGTGGG - Intergenic
1130572193 15:85056968-85056990 GATGCTGGTGACCTACAGATGGG + Intronic
1130703581 15:86210973-86210995 GATGCTGGTGACCTACAGATAGG + Intronic
1130811002 15:87378205-87378227 GATGATGGTGACATACAGATGGG - Intergenic
1132216798 15:100068743-100068765 GATGATGGTGACATACAGATGGG - Intronic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1134215192 16:12311731-12311753 GCTGCTGGAGGCAGAGAGCTTGG + Intronic
1135091521 16:19521880-19521902 GCTGCTGGTGACGCGGAGCCCGG - Exonic
1135301679 16:21334168-21334190 GATGATGGTGACATACAGATGGG + Intergenic
1136600469 16:31283878-31283900 GATGATGGTGACATACAGATGGG + Intronic
1137051816 16:35720976-35720998 GCTGATGGTGACGTACAGATGGG + Intergenic
1137343828 16:47636593-47636615 GGTGCTGATGCAACACAGCTGGG + Intronic
1137437171 16:48465371-48465393 GATGATGGTGACATACAGATGGG + Intergenic
1138859591 16:60740487-60740509 GCTGCTGCTCCCACACAGTTTGG + Intergenic
1139574528 16:67832695-67832717 ACTGCTGGTGACATAGGGCTGGG - Intronic
1140477764 16:75247476-75247498 GCTGCGGGTGACACACGTCAGGG + Intronic
1140536314 16:75713199-75713221 GCTGCTGAGGAGATACAGCTGGG + Intronic
1140537150 16:75720094-75720116 GATGATGGTGACATACAGATGGG - Intronic
1140541659 16:75761417-75761439 GCTGCTGGTGACAGCAAGCGAGG + Intronic
1141249437 16:82341738-82341760 TCTTCAGCTGACACACAGCTTGG + Intergenic
1141688814 16:85585225-85585247 GACGCCGGTGACACACAGCAGGG - Intergenic
1141908895 16:87045144-87045166 GCTCCTGGAGACCCACAGCCAGG + Intergenic
1142186004 16:88695026-88695048 GCTGAGGGTGACACAGAGCAGGG + Intergenic
1142363068 16:89636370-89636392 ACTGCTGGTGACATACAGGAAGG - Exonic
1142935235 17:3324509-3324531 GATGATGGTGACATACAGATGGG + Intergenic
1143562047 17:7702207-7702229 CCTGCTTGTGACAGACAGCATGG + Intronic
1144666109 17:17103311-17103333 GCTGATGGGGACACATGGCTGGG - Intronic
1144671658 17:17136232-17136254 GCTGCTGGTAACAGCCACCTTGG - Exonic
1145785114 17:27588518-27588540 GCTGTCGGTGACGCACAGGTAGG + Exonic
1146312686 17:31781373-31781395 GATGATGGTGACATACAGATGGG - Intergenic
1146933022 17:36791418-36791440 ACGGCAGGGGACACACAGCTTGG - Intergenic
1147527618 17:41240877-41240899 GATGATGGTGACATACAGATGGG - Intronic
1147675486 17:42202362-42202384 GAGCCTGGGGACACACAGCTGGG + Exonic
1148823724 17:50376845-50376867 CCTGCTGGTGACACCCAGCTGGG + Intronic
1148952663 17:51327387-51327409 GATGCTGGTGACCTACAGATGGG - Intergenic
1148952671 17:51327436-51327458 GATGCTGGTGACCTACAGATGGG - Intergenic
1149255508 17:54821639-54821661 GATGTTGGTGACATACAGATGGG - Intergenic
1151791536 17:76308516-76308538 GCAGCTGATGACACAAAGCATGG - Intergenic
1151820356 17:76493634-76493656 GCTCCTGGAGACAGACAGCTGGG - Intronic
1152637714 17:81436941-81436963 GGAGCTGGTGACCCAGAGCTTGG + Intronic
1153090432 18:1336185-1336207 GATGCTGGTGACCTACAGATGGG - Intergenic
1153419208 18:4885660-4885682 GCTGTTGGTGACCTACAGATGGG + Intergenic
1154097504 18:11431987-11432009 GCCGGTTGCGACACACAGCTGGG + Intergenic
1154288483 18:13083773-13083795 GATGCTGGTGACCTACAGATGGG + Intronic
1155350647 18:24902110-24902132 GATGATGGTGACATACAGATGGG - Intergenic
1155891724 18:31278616-31278638 GCTGCTGATGCCACTCAACTGGG + Intergenic
1156186570 18:34670572-34670594 GATGATGGTGACATACAGATGGG + Intronic
1156296037 18:35791587-35791609 GATGATGGTGACATACAGATGGG - Intergenic
1156481992 18:37442077-37442099 GCTCCTGCTGGCACAAAGCTGGG + Intronic
1156980902 18:43286907-43286929 GATGATGGTGACATACAGATGGG - Intergenic
1157205602 18:45695443-45695465 GATGATGGTGACATACAGATGGG - Intergenic
1157920039 18:51705762-51705784 GATGATGGTGACATACAGATGGG + Intergenic
1158423002 18:57312780-57312802 GCAGCTGCTGACAGACAGATGGG + Intergenic
1159199648 18:65167351-65167373 GATGATGGTGACATACAGATGGG - Intergenic
1160894751 19:1397182-1397204 GCTGCTGGTGACACACAGCTGGG + Intronic
1160894767 19:1397249-1397271 GCTTCTGGTGACACACAGCTGGG + Intronic
1161315550 19:3615670-3615692 GCTGCTGGTGACACACTGGGCGG + Intronic
1162724698 19:12683012-12683034 CCTGCTGGAGACCCACTGCTTGG + Intergenic
1163881063 19:19923084-19923106 GATGATGGTGACATACAGATGGG + Intronic
1163976022 19:20853037-20853059 GATGATGGTGACCCACAGATGGG - Intronic
1164120225 19:22259310-22259332 GCTGGTTGTGACATACAGCTGGG - Intergenic
1164172728 19:22739560-22739582 GCTGATTGTGACATATAGCTGGG - Intergenic
1164312608 19:24059401-24059423 TGTGATTGTGACACACAGCTTGG + Intronic
1165556130 19:36634100-36634122 GCTGCTGATGAAGCAGAGCTAGG - Intergenic
1165718607 19:38063234-38063256 GGTGCTGGACACACACAGCTGGG - Intronic
1165973140 19:39650169-39650191 GATGCTGGTGACCTACAGATGGG - Intergenic
1166438108 19:42786590-42786612 GTTGCTGGTGACATAGGGCTTGG + Intronic
1166457062 19:42950384-42950406 GTTGCTGGTGACATAGGGCTTGG + Intronic
1166486813 19:43220868-43220890 GTTGCTGGTGACATAGGGCTTGG + Intronic
1166493925 19:43284315-43284337 GTTGCTGGTGACATAGGGCTTGG + Intergenic
1166998842 19:46733052-46733074 GCTGCTGGTGAAACAGATCGAGG - Exonic
1167660856 19:50795077-50795099 TGTGCTGGTGGCACTCAGCTTGG + Exonic
1202673930 1_KI270710v1_random:23361-23383 GATGATGGTGACATACAGATGGG + Intergenic
925116937 2:1387860-1387882 GATGATGGTGACATACAGATGGG + Intronic
925260249 2:2522378-2522400 GTAACGGGTGACACACAGCTGGG - Intergenic
925742833 2:7020519-7020541 CCTGGAGCTGACACACAGCTTGG - Exonic
925956253 2:8968370-8968392 GATGATGGTGACATACAGATGGG - Intronic
926108275 2:10166028-10166050 GCTGCTGGTGACAGCTTGCTGGG + Intronic
926905171 2:17798872-17798894 ACTGCTGGTGACAACCAGCTTGG - Intronic
927058341 2:19389115-19389137 GATGATGGTGACATACAGATGGG + Intergenic
927480375 2:23449075-23449097 GATGCTGGGAACACACAGCCTGG - Intronic
927858544 2:26542962-26542984 TCTGCTGGTGACTCAGACCTGGG + Intronic
928109391 2:28494338-28494360 GCTGCTGGTGGCATGGAGCTGGG + Intronic
928120006 2:28577214-28577236 ACTGCTGGTGCCAGACAGCCAGG - Intronic
928426751 2:31185108-31185130 GCTGCAGATGGCACAAAGCTGGG - Intronic
928837761 2:35568205-35568227 GATGATGGTGACATACAGATGGG + Intergenic
928852618 2:35767426-35767448 GATGATGGTGACATACAGATGGG - Intergenic
929766510 2:44848259-44848281 GGTGCTGGAGACAGAAAGCTGGG + Intergenic
929942180 2:46342609-46342631 GTTACTGGTGACAGACATCTTGG + Intronic
930095216 2:47561472-47561494 GCAGCAGGTGCCACACAGCAGGG + Intronic
930598072 2:53411876-53411898 GATGATGGTGACATACAGATGGG - Intergenic
930922715 2:56776998-56777020 GATGATGGTGACATACAGATGGG + Intergenic
931130233 2:59327284-59327306 GATGATGGTGACATACAGATGGG - Intergenic
931491598 2:62754143-62754165 GATGATGGTGACATACAGATGGG + Intronic
931822652 2:65968220-65968242 GATGATGGTGACATACAGATGGG + Intergenic
931885660 2:66614759-66614781 GATGTTGGTGACCTACAGCTGGG + Intergenic
932540059 2:72642072-72642094 GATGCTGGTGACCTACAGATGGG - Intronic
932627257 2:73307778-73307800 GCTGCTGGCGCCCAACAGCTGGG - Intergenic
932706056 2:74026023-74026045 TTTGCTGATGACACACAACTAGG - Intronic
933016651 2:77136468-77136490 GATGATGGTGACATACAGATGGG - Intronic
933018608 2:77162811-77162833 GATGATGGTGACATACAGATGGG - Intronic
933618558 2:84510724-84510746 GATGATGGTGACATACAGATGGG + Intergenic
933880522 2:86664668-86664690 GATGCTGGTGACCTACAGATGGG - Intronic
934123965 2:88867940-88867962 TCTGCTGGTTACAGACAGCTTGG + Intergenic
934878538 2:97951336-97951358 GCTTCTGGTGCCACACAGCGGGG + Intronic
934886398 2:98029234-98029256 GGTGCTGCTCACCCACAGCTAGG + Intergenic
935118180 2:100156811-100156833 GATGATGGTGACATACAGATGGG + Intergenic
935450326 2:103201528-103201550 GATGATGGTGACATACAGGTGGG - Intergenic
935938042 2:108208286-108208308 GATGATGGTGACATACAGATGGG + Intergenic
937186687 2:120050808-120050830 GATGATGGTGACATACAGATGGG + Intronic
937632992 2:124123894-124123916 GATGATGGTGACACACAGATGGG - Intronic
938567254 2:132529844-132529866 GATGATGGTGACATACAGATGGG - Intronic
939031010 2:137075736-137075758 GATGATGGTGACATACAGATGGG + Intronic
939144290 2:138394224-138394246 GATCCTGGTGACACATGGCTAGG + Intergenic
939479344 2:142728839-142728861 GGTGATGGTGACATACAGATGGG - Intergenic
939545002 2:143541527-143541549 GATGGTGGTGACATACAGATGGG + Intronic
939893761 2:147767497-147767519 GATGATGGTGACATACAGATGGG - Intergenic
940720666 2:157278972-157278994 GATGCTGGTGACCTACAGATGGG + Intronic
940809261 2:158223811-158223833 GATGATGGTGACATACAGATGGG - Intronic
940970040 2:159886076-159886098 GCTGCAGATGAAACACAGCATGG + Intronic
941550754 2:166912756-166912778 GATGATGGTGACATACAGATGGG + Intronic
942411835 2:175717560-175717582 GATGATGGTGACATACAGATGGG - Intergenic
942753662 2:179315467-179315489 GATGATGGTGACATACAGATGGG - Intergenic
943233684 2:185290829-185290851 GATGCTGGTGACTTACAGATGGG - Intergenic
944906294 2:204265194-204265216 CCTCCTGGTAACCCACAGCTGGG - Intergenic
945481610 2:210351599-210351621 GATGATGGTGACATACAGATGGG - Intergenic
945495889 2:210506375-210506397 GATGATGGTGACATACAGATGGG - Intronic
945544418 2:211132321-211132343 TCTGCTCATGAAACACAGCTTGG - Intergenic
945721168 2:213420989-213421011 GCTGCAGGAGAGTCACAGCTGGG + Intronic
945870531 2:215221232-215221254 GCTGATGGTAACATACAGATGGG - Intergenic
945873619 2:215253946-215253968 GCTGATGGTGACGTACAGATGGG - Intergenic
947440509 2:230117259-230117281 GATGATGGTGACCCACAGATGGG + Intergenic
947634341 2:231672624-231672646 GCTGCGGGTGGCAGACAGCTGGG + Intergenic
948781427 2:240324137-240324159 GCTGCTGATGGCTCACAGCCAGG - Intergenic
1170438624 20:16355247-16355269 GCTGCTGGGCACACACAGAGTGG - Intronic
1171024311 20:21614782-21614804 CCTGCTGGTGCCACAGAGCAGGG + Intergenic
1171140380 20:22735632-22735654 GATGATGGTGACATACAGATGGG - Intergenic
1171153771 20:22852374-22852396 GATGCTGGTGACCTACAGATGGG - Intergenic
1171168252 20:22992723-22992745 GATGATGGTGACATACAGATGGG + Intergenic
1171268064 20:23789441-23789463 GATGATGGTGACATACAGATGGG - Intergenic
1171378986 20:24718881-24718903 GGTGCTGGTGACTCACATCAAGG - Intergenic
1171514675 20:25719862-25719884 GATGCTGGTGACCAACAGATGGG + Intergenic
1171782896 20:29437278-29437300 GATGAGTGTGACACACAGCTAGG - Intergenic
1171838360 20:30178455-30178477 TCTGCTGGTGAAATACTGCTTGG + Intergenic
1172165221 20:32894640-32894662 GCTCCAGGTCACACAGAGCTGGG - Intronic
1172456202 20:35076414-35076436 GATGATGGTGACATACAGATGGG + Intronic
1172854720 20:37993152-37993174 CCTGGTGGTAACACACAGCAAGG + Intronic
1173650811 20:44662996-44663018 GGTGCTGGGGACACACAGTGAGG + Intergenic
1173872738 20:46351983-46352005 GCTGCTGGTGAGAAACCCCTGGG + Intronic
1174223981 20:48982139-48982161 GATGCTGGTGACCTACAGATGGG + Intronic
1174694589 20:52543912-52543934 GATGATGGTGACATACAGATGGG - Intergenic
1175803904 20:61816774-61816796 CCCGCTGCTGACACAGAGCTGGG + Intronic
1176208466 20:63904375-63904397 TCTGCTGGTGACAATCAGTTAGG - Intronic
1176635376 21:9188231-9188253 GATGATGGTGACATACAGATGGG + Intergenic
1176637999 21:9266900-9266922 GATGATGGTGACATACAGATGGG - Intergenic
1179613824 21:42569142-42569164 GCAGCAAGTGACACACAGGTTGG - Intronic
1179971435 21:44838231-44838253 GCTGCTGGTCCCGCAGAGCTGGG + Intergenic
1180422038 22:12874397-12874419 GATGATGGTGACATACAGATGGG - Intergenic
1181342040 22:22188818-22188840 GATGATGGTGACATACAGATGGG - Intergenic
1181618671 22:24072464-24072486 GCTGCTGGTGGCACAGAGAATGG - Exonic
1181846106 22:25710068-25710090 GATGCTGGGGAGACACAGCCAGG - Intronic
1182041020 22:27239221-27239243 GCTGCAGCTGACACAGAGCCTGG - Intergenic
1182157105 22:28084502-28084524 GATGATGGTGACATACAGATGGG - Intronic
1182167681 22:28192280-28192302 GATGATGGTGACATACAGATGGG - Intronic
1182330591 22:29548974-29548996 GCTGCTGCAAACACACAGCCAGG + Intronic
1183045137 22:35213309-35213331 GCTCCTGGTCACAGACAGCCTGG - Intergenic
1183592565 22:38788691-38788713 GCTGCTCGCCACACACAGCAGGG + Intronic
1183965220 22:41437446-41437468 GCTGGTGGTGACCAACAGCTAGG + Intronic
1184493775 22:44825676-44825698 GCTGCTGGAGACAAACGTCTGGG - Intronic
1184771565 22:46599924-46599946 GCCGGTGGTGAGACACACCTGGG - Intronic
1184973608 22:48045516-48045538 ACTGTTGAAGACACACAGCTGGG - Intergenic
1185012665 22:48323955-48323977 GGTCCTGGAGACCCACAGCTAGG - Intergenic
1185151540 22:49166838-49166860 GCTGCTGGTGACCCTCAGGATGG + Intergenic
1185197519 22:49481652-49481674 CCTGCTGGGGAAACCCAGCTGGG - Intronic
950448467 3:13052119-13052141 CATGCTGGCCACACACAGCTAGG - Intronic
950500040 3:13358030-13358052 TATGCAGGGGACACACAGCTTGG - Intronic
950862655 3:16164002-16164024 GATGATGGTGACATACAGATGGG + Intergenic
951286521 3:20820549-20820571 GATGATGGTGACATACAGATGGG + Intergenic
951330843 3:21365830-21365852 GATGATGGTGACATACAGATGGG - Intergenic
952073815 3:29671265-29671287 GATGATGGTGACCCACAGGTGGG - Intronic
952103584 3:30043419-30043441 GCTGCTGGGGAGACACAATTAGG + Intergenic
952104276 3:30051104-30051126 GATGATGGTGACATACAGATGGG - Intergenic
952336863 3:32411086-32411108 CCTGCGGCTGACACAGAGCTGGG - Intronic
952513912 3:34084868-34084890 GATGATGGTGACATACAGATGGG + Intergenic
952709404 3:36414819-36414841 GATGATGGTGACATACAGATGGG + Intronic
952787971 3:37175498-37175520 GCTGCTGGTTACTCACAGGCAGG + Intronic
952917081 3:38254817-38254839 GCTGCTGCTCACTCCCAGCTAGG - Exonic
953078547 3:39593879-39593901 GCTGCTGGTGTCAAAGGGCTGGG + Intergenic
954513658 3:51151424-51151446 GATGCTGGTGACCTACAGATAGG - Intronic
954524272 3:51256021-51256043 GATGATGGTGACATACAGATGGG + Intronic
955854342 3:63256560-63256582 GATGATGGTGACATACAGATGGG - Intronic
956268881 3:67428433-67428455 GATGATGGTGACGCACAGATGGG - Intronic
956866390 3:73373610-73373632 GATGATGGTGACATACAGATGGG + Intergenic
957044788 3:75365105-75365127 GCTGCAGCTGACAAACAGGTCGG + Intergenic
957082591 3:75649314-75649336 GATGAATGTGACACACAGCTAGG + Intergenic
957102860 3:75850146-75850168 GATGATGGTGACATACAGATGGG + Intergenic
957130285 3:76215153-76215175 GATGATGGTGACATACAGATGGG - Intronic
957296010 3:78333388-78333410 GGTGATGGTAACACACAGGTGGG - Intergenic
957604057 3:82375449-82375471 GATGATGGTGACATACAGATGGG + Intergenic
957867189 3:86040074-86040096 GATGATGGTGACATACAGATGGG - Intronic
958162322 3:89832692-89832714 GATGATGGTGACATACAGATGGG - Intergenic
958811009 3:98859715-98859737 GATGTTGGTGACATACAGATGGG - Intronic
958861574 3:99451016-99451038 GATGATGGTGACATACAGATGGG - Intergenic
958978147 3:100690518-100690540 GGTGATGGTGACATACAGGTGGG + Intronic
959353489 3:105297074-105297096 GATGATGGTGATATACAGCTGGG - Intergenic
960051120 3:113240473-113240495 ACTACTGGTGACAAACAACTTGG - Intronic
960369134 3:116811705-116811727 GCTGCTGGGGTCAGACTGCTGGG + Intronic
960835964 3:121907509-121907531 GATGCTGGTGACCTACAGATGGG + Intronic
961277637 3:125740519-125740541 GCTGCAGCTGACAAACAGGTCGG - Intergenic
961356094 3:126340906-126340928 CCTGGGGGTGCCACACAGCTGGG + Intergenic
961613986 3:128164405-128164427 GCTGGAGGAGACACACGGCTGGG + Intronic
961876783 3:130029143-130029165 GCTGCAGCTGACAAACAGGTCGG + Intergenic
962460276 3:135605206-135605228 GATGATGGTGACATACAGATGGG - Intergenic
962907533 3:139818389-139818411 GATGATGGTGACATACAGATGGG + Intergenic
963303250 3:143621606-143621628 GATGATGGTGACATACAGATGGG - Intronic
963678836 3:148348245-148348267 GATGATGGTGACATACAGATGGG - Intergenic
964100360 3:152981182-152981204 GATGATGGTGACATACAGATGGG - Intergenic
964228840 3:154438723-154438745 GATGATGGTGACATACAGATGGG + Intergenic
964564551 3:158035120-158035142 GATGATGGTGACATACAGATGGG - Intergenic
964694510 3:159492091-159492113 GATGATGGTGACATACAGATGGG - Intronic
964696187 3:159510618-159510640 GATGATGGTGACATACAGATGGG + Intronic
964701623 3:159574268-159574290 GATGTTGGTGACCCACAGATGGG + Intronic
965973188 3:174588527-174588549 GATGATGGTGACATACAGATGGG + Intronic
967248591 3:187513677-187513699 GATGATGGTGACATACAGATGGG - Intergenic
967339158 3:188377856-188377878 GATGATGGTGACATACAGGTGGG + Intronic
1202748896 3_GL000221v1_random:138121-138143 GATGATGGTGACATACAGATGGG + Intergenic
968600860 4:1508655-1508677 GCTGCTGGGGCCACACACCTGGG - Intergenic
968651744 4:1762934-1762956 GGTCCTAGTGACCCACAGCTCGG - Intergenic
969785260 4:9452708-9452730 GCTGCAGCTGACAAACAGGTCGG - Intergenic
969804572 4:9596922-9596944 GCTGCTGCTGTAACCCAGCTGGG + Intergenic
969998827 4:11343372-11343394 GCTGCTTGTGCCACACAGGGTGG - Intergenic
970952681 4:21775434-21775456 GCTCCTTGTGCCACTCAGCTGGG - Intronic
973055442 4:45652161-45652183 GATGATGGTGACATACAGATGGG - Intergenic
973326662 4:48869729-48869751 GATGATGGTGACACACAGGTGGG + Intergenic
973671058 4:53218792-53218814 GATGATGGTGACATACAGATGGG + Intronic
973835853 4:54808058-54808080 GATGCTGATGACCTACAGCTGGG - Intergenic
974276185 4:59723905-59723927 GATGATGGTGACATACAGATGGG + Intergenic
974287892 4:59892937-59892959 GATGATGGTGACATACAGATGGG - Intergenic
974367915 4:60976069-60976091 GATGATGGTGACATACAGATGGG - Intergenic
974717802 4:65693449-65693471 GCTGCTTTTGACTCATAGCTTGG + Intergenic
975034337 4:69661785-69661807 GATGATGGTGACATACAGATGGG - Intergenic
975255996 4:72236020-72236042 GATGATGGTGACATACAGATGGG + Intergenic
975287063 4:72633024-72633046 GATGATGGTGACATACAGATGGG - Intergenic
975348476 4:73320378-73320400 GATGATGGTGACATACAGATGGG - Intergenic
975726826 4:77300643-77300665 GATGATGGTGACATACAGATAGG + Intronic
977492993 4:97737202-97737224 GATGATGGTGACATACAGATGGG - Intronic
977699495 4:100005680-100005702 GATGATGGTGATACACAGATGGG + Intergenic
978012841 4:103708497-103708519 GATGATGGTGACATACAGATGGG - Intronic
978060060 4:104326619-104326641 GATGATGGTGACATACAGATGGG + Intergenic
978188083 4:105881137-105881159 GATGATGGTGACATACAGATGGG - Intronic
978245116 4:106563242-106563264 GATGATGGTGACATACAGATGGG + Intergenic
979886203 4:126030721-126030743 GATGATGGTGACATACAGATGGG - Intergenic
980090317 4:128436652-128436674 GATGATGGTGACATACAGATGGG + Intergenic
981029746 4:140112534-140112556 GCTTCTGGCCACACACAGCTGGG + Intronic
981099757 4:140817037-140817059 CCTGCTGGTGATAAACAGCCTGG + Intergenic
981668324 4:147256019-147256041 GATGATGGTGACATACAGATGGG - Intergenic
982323131 4:154101141-154101163 GCTGCTGGAGATACACAGTGAGG - Intergenic
982771179 4:159398965-159398987 GCCCCTGATGACCCACAGCTTGG - Intergenic
982820074 4:159934222-159934244 GATGATGGTGACATACAGATGGG + Intergenic
982901103 4:161003630-161003652 GCTGCTGTTGCGACCCAGCTGGG - Intergenic
983598701 4:169499552-169499574 GATGATGGTGACATACAGATGGG + Intronic
983978664 4:173968043-173968065 GATGATGGTGACATACAGATGGG + Intergenic
984015128 4:174417045-174417067 GATGATGGTGACATACAGATGGG + Intergenic
984653282 4:182291491-182291513 GCTGCGTGGGACACACAGCGGGG - Intronic
985193902 4:187407585-187407607 GATGTTGGTGACATACAGTTGGG + Intergenic
1202752896 4_GL000008v2_random:25317-25339 GATGATGGTGACATACAGATGGG - Intergenic
985827790 5:2205436-2205458 GCTGCTGGTGAAGCCCAGCGTGG - Intergenic
985838762 5:2290099-2290121 GGTGCTGCTGACACACACCGAGG + Intergenic
985921896 5:2984046-2984068 GCAGGTGGTGACACCCAGCAAGG + Intergenic
987875513 5:23675565-23675587 GCTGCTGGAGTCAGACAGATGGG - Intergenic
989072279 5:37523471-37523493 GATGATGGTGACATACAGATGGG - Intronic
989662295 5:43813325-43813347 GATGATGGTGACATACAGATGGG + Intergenic
990135735 5:52642325-52642347 GATGATGGTGACATACAGATGGG - Intergenic
990188043 5:53229285-53229307 GATGATGGTGACATACAGATGGG + Intergenic
990226851 5:53664978-53665000 GATGATGGTGACATACAGATGGG + Intronic
990340150 5:54813939-54813961 GATGATGGTGACATACAGATGGG - Intergenic
990360495 5:55013825-55013847 GATGATGGTGACATACAGATGGG - Intronic
990482254 5:56222336-56222358 GATGATGGTGACATACAGATGGG - Intronic
990527035 5:56638317-56638339 GCTCCTGTTTACACACAGCCTGG + Intergenic
990653053 5:57923833-57923855 GATGATGGTGACATACAGATGGG - Intergenic
990672722 5:58150675-58150697 GCTTCTAGCCACACACAGCTTGG + Intergenic
990945001 5:61239852-61239874 GATGATGGTGACGCACAGATGGG - Intergenic
991538911 5:67704650-67704672 GATGATGGTGACATACAGATGGG - Intergenic
992183552 5:74221959-74221981 GATGATGGTGACATACAGATGGG + Intergenic
992257290 5:74933825-74933847 GCTGCAGGTCACACAGAGATTGG + Intergenic
992274576 5:75102082-75102104 GATGATGGTGACATACAGATGGG + Intronic
992631258 5:78682929-78682951 GATGCTGGTGACGTACAGATGGG - Intronic
992782493 5:80140852-80140874 GCTGCTGGTCAGACACATTTAGG - Exonic
992973228 5:82083814-82083836 GATGATGGTGACATACAGATGGG - Intronic
993046408 5:82872028-82872050 GATGATGGTGACGTACAGCTGGG + Intergenic
993627127 5:90239244-90239266 GGTGATGGTGACATACAGATGGG - Intergenic
994218869 5:97171488-97171510 GCTGCTGGGGATACACAGCATGG - Intronic
995459846 5:112391057-112391079 GATGATGGTGACCTACAGCTGGG - Intronic
995467452 5:112465884-112465906 GATGATGGTGACATACAGATGGG + Intergenic
995665335 5:114535802-114535824 GATGATGGTGACATACAGATGGG + Intergenic
995692742 5:114845393-114845415 GATGGTGGTGACATACAGATGGG - Intergenic
996782071 5:127198144-127198166 GCTGCTGGTGATGTACAGATGGG - Intergenic
999064676 5:148673346-148673368 GATGATGGTGACATACAGATGGG + Intronic
999447793 5:151654631-151654653 GGTGCTGGTGAGAAACACCTTGG - Intergenic
999754081 5:154651728-154651750 GATGCTGGTCACTCACAGGTGGG + Intergenic
1000648024 5:163781601-163781623 GATGATGGTGACATACAGATGGG - Intergenic
1001042083 5:168343472-168343494 GCTGCTGCTGACAAGCAGCATGG - Intronic
1001292515 5:170473908-170473930 GGTGCAGGTGACACAGGGCTAGG + Intronic
1001987006 5:176083318-176083340 GATGATGGTGACATACAGATGGG + Intronic
1002010229 5:176273422-176273444 GATGATGGTGACATACAGATGGG - Intronic
1002173933 5:177390976-177390998 TGCTCTGGTGACACACAGCTGGG + Intronic
1002229865 5:177754829-177754851 GATGATGGTGACATACAGATGGG - Intronic
1002265482 5:178028948-178028970 GATGATGGTGACATACAGATGGG + Intronic
1002298158 5:178242534-178242556 GCTGTAGGTGATACACTGCTGGG + Intronic
1002469854 5:179428794-179428816 GCCCCTGGGGACACACAGGTGGG - Intergenic
1003026272 6:2558322-2558344 GCTGCAGGTGCCACACCCCTTGG - Intergenic
1003782491 6:9444713-9444735 GATGATGGTGACATACAGATGGG - Intergenic
1004308696 6:14524245-14524267 ACTGCTGGGGAGAAACAGCTAGG + Intergenic
1005179164 6:23084023-23084045 GCTTCTGGTGGCTCACAGCAAGG - Intergenic
1005941408 6:30562949-30562971 GCTGCTTGTGAAACTCAGCCAGG + Exonic
1006121773 6:31811281-31811303 ACTGCTGGGGACACTCACCTGGG - Exonic
1006131284 6:31870855-31870877 GTTGGTGGTGAAACCCAGCTGGG + Exonic
1007061631 6:38946241-38946263 GCTGCTAGTGACTGACAGATGGG + Intronic
1007415274 6:41687948-41687970 GCTGCTGGTGACGCCCACCAGGG + Exonic
1007567644 6:42864703-42864725 GCTGCTCATGAGACACAGTTTGG + Exonic
1007985182 6:46200345-46200367 GCTTCTGCTGACCCACAACTTGG + Intergenic
1008281352 6:49599532-49599554 GATGATGGTGACATACAGATGGG - Intergenic
1008349979 6:50478501-50478523 GATGATGGTGACATACAGATGGG - Intergenic
1008566708 6:52776380-52776402 GATGATGGTGACATACAGATGGG + Intergenic
1009410856 6:63363185-63363207 GATGATGGTGACATACAGATGGG - Intergenic
1009503704 6:64448847-64448869 GATGATGGTGACATACAGATGGG - Intronic
1010281634 6:74029824-74029846 GATGATGGTGACATACAGATGGG + Intergenic
1010683021 6:78818497-78818519 GATGATGGTGACATACAGATGGG - Intergenic
1010791989 6:80075468-80075490 GCAGCTGCTAACAAACAGCTTGG + Intergenic
1010912743 6:81579529-81579551 GATGATGGTGACATACAGATGGG - Intronic
1010944435 6:81958181-81958203 GATGATGGTGACATACAGATGGG + Intergenic
1011012355 6:82716192-82716214 GATGATGGTGACATACAGATGGG - Intergenic
1011303003 6:85896121-85896143 GATGATGGTGACATACAGATGGG + Intergenic
1011306688 6:85935591-85935613 GATGATGGTGACATACAGATGGG + Intergenic
1011338068 6:86283283-86283305 GATGATGGTGACATACAGATGGG + Intergenic
1011363286 6:86551381-86551403 GATGATGGTGACATACAGATGGG + Intergenic
1011760807 6:90563063-90563085 GATGATGGTGACATACAGATGGG - Intronic
1011949954 6:92952848-92952870 GATGATGGTGACATACAGATGGG - Intergenic
1012170486 6:96011815-96011837 GGAGCTGGTGACACATAGCTGGG - Intergenic
1012184026 6:96191057-96191079 GATGATGGTGACATACAGATGGG + Intronic
1012228976 6:96737791-96737813 GCTGCTGGTAAGCCCCAGCTTGG - Intergenic
1012725770 6:102808571-102808593 GATGCTGGTGACCTACAGATGGG + Intergenic
1013906250 6:115223050-115223072 GATGATGGTGACATACAGATGGG - Intergenic
1014529479 6:122542333-122542355 GATGATGGTGACACACAGAAGGG + Intronic
1015893150 6:137989324-137989346 GATGATGGTGACATACAGATGGG + Intergenic
1016102153 6:140115708-140115730 GATGCTGGTGACCTACAGATGGG - Intergenic
1016241978 6:141941077-141941099 GCTGTTGGTGACCCTCAGATGGG - Intergenic
1016875769 6:148863655-148863677 GATGATGGTGACATACAGATGGG + Intronic
1019210043 6:170397615-170397637 GCTGATGATGGCACACAGCTTGG + Intronic
1020311907 7:6874449-6874471 GCTGCAGCTGACAAACAGGTCGG + Intergenic
1020622454 7:10534177-10534199 GATGATGGTGACATACAGATGGG - Intergenic
1021487304 7:21181798-21181820 GATGATGGTGACATACAGATGGG + Intergenic
1022347330 7:29528975-29528997 GATGCTGGTGACCTACAGATGGG - Intergenic
1022558238 7:31322476-31322498 GTTGCTGGTCACACAGACCTGGG + Intergenic
1023510991 7:40953602-40953624 GATGATGGTGACATACAGGTGGG + Intergenic
1024016088 7:45316258-45316280 GATGCTGGTGACATACAGATGGG - Intergenic
1024205946 7:47160642-47160664 GATGATGGTGACATACAGATGGG - Intergenic
1024208730 7:47185877-47185899 GCTGATGGTGACAGAGAGCAAGG - Intergenic
1024552560 7:50575984-50576006 GATGATGGTGACATACAGATGGG + Intergenic
1024916285 7:54503871-54503893 GATGATGGTGACATACAGATGGG + Intergenic
1026285773 7:68961546-68961568 GGTGCTGATGCCACACAGATAGG - Intergenic
1026631660 7:72043085-72043107 GCTGCTGGTGACACAAGGTAGGG + Intronic
1027493566 7:78860395-78860417 GATGATGGTGACATACAGATGGG + Intronic
1028043071 7:86081669-86081691 TCTGCTGTTAACACACATCTAGG + Intergenic
1029057486 7:97761388-97761410 GATGATGGTGACATACAGATAGG - Intergenic
1030179343 7:106689521-106689543 GATGATGGTGACATACAGATGGG + Intergenic
1030265851 7:107621121-107621143 GCTGGTGGTGGCGCACAGATGGG - Exonic
1030449614 7:109692285-109692307 GATGATGGTGACATACAGATGGG + Intergenic
1030467735 7:109924235-109924257 GATGATGGTGACGCACAGATGGG + Intergenic
1030476080 7:110035278-110035300 GATGATGGTGACATACAGATGGG + Intergenic
1030510141 7:110473195-110473217 GATGATGGTGACATACAGATGGG - Intergenic
1031040768 7:116836413-116836435 GCTGGTGGGGACAGACAGCAAGG + Intronic
1032238672 7:130144445-130144467 GTTGCTGGTTACACACAGCGAGG - Intergenic
1032686589 7:134240040-134240062 GATGATGGTGACATACAGATGGG - Intronic
1033150816 7:138913744-138913766 GCTGCTGGTGTGACTCAGCAAGG - Intronic
1033714536 7:143986043-143986065 GCTTTTGTTGACACACAGCAAGG + Intergenic
1033902352 7:146158225-146158247 GATGATGGTGACATACAGATAGG - Intronic
1033914323 7:146305429-146305451 GATGATGGTGACATACAGATGGG + Intronic
1034371171 7:150598076-150598098 GATGATGGTGACATACAGATGGG - Intergenic
1034507621 7:151506853-151506875 GCTGGTGGTGCTACACAGCTGGG + Intronic
1034541900 7:151763758-151763780 GCATCTGGAGACAGACAGCTGGG - Intronic
1034846450 7:154450774-154450796 GCTGATGATCTCACACAGCTGGG + Intronic
1035043881 7:155951605-155951627 GCTGCTGGTGACTCAAGGCCGGG + Intergenic
1036262437 8:7251208-7251230 GCTGCAGCTGACAAACAGGTCGG + Intergenic
1036304151 8:7588350-7588372 GCTGCAGCTGACAAACAGGTCGG - Intergenic
1036314476 8:7709747-7709769 GCTGCAGCTGACAAACAGGTCGG + Intergenic
1036355005 8:8036342-8036364 GCTGCAGCTGACAAACAGGTCGG - Intergenic
1036516159 8:9446458-9446480 GATGATGGTGACATACAGATGGG + Intergenic
1036759490 8:11497452-11497474 GTTGCTGGGGACACACAAATGGG - Intronic
1037103270 8:15074141-15074163 GCTGATGGTCACAGACATCTGGG - Intronic
1037546775 8:19931138-19931160 GATGATGGTGACATACAGATGGG - Intronic
1037641079 8:20743669-20743691 GATGATGGTGACATACAGATTGG - Intergenic
1037808510 8:22072003-22072025 GCTGCTGGGGACACTGAACTAGG - Intronic
1037902674 8:22696763-22696785 GCTGGTGGTGACACAAGGCAGGG + Intergenic
1037999414 8:23379084-23379106 GATGATGGTGACATACAGATGGG + Intronic
1038221643 8:25614509-25614531 GATGATGGTGACACCCAGATGGG + Intergenic
1038366379 8:26940089-26940111 GATGATGGTGACATACAGATGGG + Intergenic
1039154655 8:34541209-34541231 GATGATGGTGACATACAGATGGG - Intergenic
1039342933 8:36671535-36671557 GATGCTGGTGACCTACAGATGGG + Intergenic
1039633965 8:39143365-39143387 GATGTTGGTGACCCACAGATGGG + Intronic
1039707348 8:40021547-40021569 GATGATGGTGACATACAGATGGG + Intergenic
1039719094 8:40143347-40143369 GATGATGGTGACATACAGATGGG + Intergenic
1039893861 8:41702308-41702330 GCTGCTGCTAACACACATCTAGG - Intronic
1040086583 8:43349588-43349610 GATGATGGTGACATACAGATGGG + Intergenic
1040097328 8:43459082-43459104 GATGATGGTGACATACAGATGGG + Intergenic
1040403490 8:47076488-47076510 GATGATGGTGACATACAGATGGG - Intergenic
1040749831 8:50692400-50692422 GATGATGGTGACATACAGATGGG + Intronic
1040865598 8:52046485-52046507 GATGATGGTGACATACAGATGGG + Intergenic
1040992798 8:53369975-53369997 GATGATGGTGACATACAGATGGG - Intergenic
1041035513 8:53785688-53785710 GATGATGGTGACATACAGATGGG + Intronic
1041120943 8:54586147-54586169 GATGATGGTGACAAACAGATGGG + Intergenic
1041388111 8:57326087-57326109 GGTGATGGTGACATACAGATGGG + Intergenic
1041518322 8:58726975-58726997 GATGATGGTGACATACAGATGGG - Intergenic
1041842942 8:62293387-62293409 GATGATGGTGACATACAGATGGG + Intronic
1043048680 8:75359010-75359032 GATGATGGTGACATACAGATGGG + Intergenic
1043129311 8:76441565-76441587 GCTGTTGGTGACCTACAGATGGG + Intergenic
1043279516 8:78445825-78445847 GATGATGGTGACATACAGATGGG - Intergenic
1043626498 8:82267195-82267217 GCTGATGGTCAGACAGAGCTGGG + Intergenic
1044061931 8:87649001-87649023 GATGATGGTGACATACAGATGGG - Intergenic
1044221311 8:89673113-89673135 GATGATGGTGACTCACAGATGGG - Intergenic
1044402522 8:91788775-91788797 GATGATGGTGACATACAGATGGG - Intergenic
1044449088 8:92313307-92313329 GATGATGGTGACATACAGATGGG + Intergenic
1044811882 8:96071394-96071416 GATGATGGTGACATACAGATGGG - Intergenic
1045101170 8:98845980-98846002 ACTGCTGGTTGCACAGAGCTAGG + Intronic
1045368975 8:101502295-101502317 GCTGGTGGTGGCTCACAGCAGGG + Intronic
1046608005 8:116391696-116391718 GATGCTGGTGACCTACAGATGGG - Intergenic
1047030967 8:120880150-120880172 GGTGCTGATGACTCACAGGTGGG - Intergenic
1047307570 8:123665388-123665410 GGAGCTGGTGACACCCAGCATGG + Intergenic
1047679777 8:127242812-127242834 GCTGCTTGGGACACAAAACTGGG + Intergenic
1049423314 8:142526319-142526341 GGTGCGGGTGACACACAGAGAGG + Intronic
1049448090 8:142640910-142640932 GCCGCTGAAGACACACAGCTAGG - Intergenic
1050034763 9:1423895-1423917 GATGATGGTGACATACAGATGGG + Intergenic
1050320794 9:4449830-4449852 GATGCTGGTGACCTACAGATAGG - Intergenic
1050381257 9:5032737-5032759 GATGATGGTGACATACAGATGGG - Intronic
1050500907 9:6296335-6296357 GATGATGGTGACATACAGATGGG - Intergenic
1050887058 9:10779258-10779280 GATGATGGTGACATACAGATGGG - Intergenic
1051085476 9:13343741-13343763 GATGATGGTGACGTACAGCTGGG - Intergenic
1051300515 9:15645229-15645251 GATGATGGTGACATACAGATGGG - Intronic
1051987340 9:23106071-23106093 GATGATGGTGACATACAGATGGG - Intergenic
1052496217 9:29228759-29228781 GATGCAGATGACACAAAGCTGGG + Intergenic
1052640410 9:31160098-31160120 GATGATGGTGACATACAGTTGGG + Intergenic
1052645537 9:31229662-31229684 GATGATGGTGACATACAGATGGG + Intergenic
1052992830 9:34531693-34531715 GATGATGGTGACATACAGATGGG + Intergenic
1053423230 9:37994218-37994240 TTTGCTGGGGTCACACAGCTTGG - Intronic
1055899505 9:81218135-81218157 GATGATGGTGACATACAGATGGG - Intergenic
1056426251 9:86480353-86480375 GATGATGGTGACATACAGATAGG + Intergenic
1056829862 9:89907070-89907092 GATGCTGGTGACCCACAGATGGG - Intergenic
1057175845 9:92998628-92998650 GATGATGGTGACATACAGATGGG + Intronic
1057327619 9:94080129-94080151 GCTGCTGCTGCCACCCACCTGGG - Intronic
1057342788 9:94217714-94217736 GATGATGGTGACATACAGATGGG - Intergenic
1058224050 9:102338199-102338221 GATGCTGGTGACGTACAGGTGGG - Intergenic
1058563900 9:106260509-106260531 GATGATGGTGACATACAGATGGG + Intergenic
1060049951 9:120371456-120371478 GCTGCCAGCGACACACAACTTGG - Intergenic
1060332212 9:122683331-122683353 GCTGCAGCTGCCACTCAGCTGGG + Intergenic
1060751856 9:126174734-126174756 GCTGCTGGAGCCACTCAGCCTGG + Intergenic
1061481664 9:130900472-130900494 GCTGCTTGGGCCACACAGTTTGG + Intergenic
1061505959 9:131032040-131032062 GGTGCTGGTGACCCACTCCTGGG - Exonic
1061574345 9:131496798-131496820 GCTGCTGGTGGCTCCCAGGTTGG + Exonic
1062208125 9:135348409-135348431 GCTGGTGGTGGCACAAAGCTGGG + Intergenic
1203758152 Un_GL000218v1:155537-155559 GATGATGGTGACATACAGATGGG + Intergenic
1203717537 Un_KI270742v1:168211-168233 GATGATGGTGACATACAGATGGG + Intergenic
1203533688 Un_KI270743v1:10022-10044 GATGATGGTGACATACAGATGGG - Intergenic
1203651753 Un_KI270751v1:131802-131824 GATGATGGTGACATACAGATGGG + Intergenic
1185464148 X:345398-345420 GCAGCTGCAGACACAGAGCTGGG + Intronic
1186914513 X:14205763-14205785 GATGCTGGTGACATACAGATGGG - Intergenic
1187624031 X:21090158-21090180 GATGATGGTGACACACTGATGGG - Intergenic
1187835457 X:23428445-23428467 GATGCTGGTGACGTACAGATGGG + Intergenic
1187987816 X:24833643-24833665 GATGCTGGGGAAAAACAGCTAGG - Intronic
1189603532 X:42651703-42651725 GATGATGGTGACATACAGATGGG - Intergenic
1190554935 X:51624108-51624130 GATGATGGTGACATACAGATGGG - Intergenic
1190602281 X:52105728-52105750 GGTGATGGTGACATACAGGTGGG + Intergenic
1190608732 X:52171756-52171778 GATGATGGTGACATACAGATGGG - Intergenic
1190683332 X:52848687-52848709 GATGATGGTGACCCACAGATGGG + Intergenic
1190708307 X:53048591-53048613 GATGCTGGGGACACCCAGCCTGG - Intergenic
1190720835 X:53145990-53146012 GATGATGGTGACATACAGATGGG - Intergenic
1190962964 X:55270071-55270093 GATGATGGTGACATACAGATGGG - Intronic
1190966039 X:55302794-55302816 GATGATGGTGACATACAGATGGG + Intergenic
1191017759 X:55828066-55828088 GATGATGGTGACATACAGATGGG - Intergenic
1191020143 X:55850913-55850935 GATGATGGTGACATACAGGTGGG + Intergenic
1191028116 X:55937365-55937387 GATGATGGTGACATACAGATGGG - Intergenic
1191032567 X:55990650-55990672 GATGATGGTGACATACAGATGGG + Intergenic
1191048168 X:56161920-56161942 GATGATGGTGACATACAGATGGG + Intergenic
1191076590 X:56460350-56460372 GATGATGGTGACATACAGTTGGG + Intergenic
1191138262 X:57090148-57090170 GATGATGGTGACATACAGATGGG + Intergenic
1191588919 X:62859059-62859081 GATGATGGTGACATACAGATGGG - Intergenic
1191625454 X:63266226-63266248 GATGATGGTGACAAACAGGTGGG + Intergenic
1191628141 X:63291081-63291103 GATGATGGTGACATACAGATGGG + Intergenic
1191683467 X:63865485-63865507 GATGCTGGTGACGTACAGATGGG + Intergenic
1191748333 X:64513945-64513967 GATGATGGTGACATACAGATGGG - Intergenic
1191751584 X:64548937-64548959 GATGATGGTGACATACAGATGGG + Intergenic
1191799138 X:65058232-65058254 GATGATGGTGACATACAGATGGG + Intergenic
1191828189 X:65388792-65388814 GATGATGGTGACATACAGATGGG + Intronic
1192004126 X:67191576-67191598 GATGATGGTGACATACAGATGGG + Intergenic
1192049227 X:67708791-67708813 GATGATGGTGACATACAGATGGG + Intronic
1192097298 X:68225712-68225734 GATGATGGTGACGCACAGATGGG - Intronic
1192159898 X:68776648-68776670 GATGTTGGTGACATACAGATGGG - Intergenic
1192344128 X:70287419-70287441 GCTATTAGTGACACACAGGTTGG - Intronic
1192389942 X:70715941-70715963 GATGATGGTGACAAACAGATGGG + Intronic
1192391134 X:70729153-70729175 GATGATGGTGACAAACAGATGGG - Intronic
1192683811 X:73282339-73282361 GATGATGGTGACAAACAGATGGG - Intergenic
1192879289 X:75265828-75265850 GATGATGGTGACATACAGATGGG + Intergenic
1192922208 X:75719058-75719080 GATGATGGTGACATACAGATGGG + Intergenic
1193073926 X:77334940-77334962 GATGCTGGTGACCAACAGATGGG - Intergenic
1193281426 X:79655592-79655614 GGTGCTGGTGACCTACAGATGGG + Intergenic
1193367438 X:80651554-80651576 GATGATGGTGACATACAGATGGG - Intergenic
1193770731 X:85584140-85584162 GATGATGGTGACATACAGATGGG - Intergenic
1194303645 X:92216046-92216068 GATGATGGTGACATACAGATGGG - Intronic
1194924328 X:99806173-99806195 GATGATGGTGACATACAGATGGG - Intergenic
1195203840 X:102575279-102575301 GATGATGGTGACATACAGATGGG - Intergenic
1195340495 X:103902265-103902287 GATGATGGTGACATACAGATGGG + Intergenic
1195664124 X:107413087-107413109 GCTGCAGCTGCCACATAGCTAGG - Intergenic
1195787858 X:108547259-108547281 GATGATGGTGACATACAGATGGG + Intronic
1195846060 X:109229766-109229788 GATGTTGGTGACTCACAGATGGG - Intergenic
1195847866 X:109248167-109248189 GATGTTGGTGACTCACAGATGGG + Intergenic
1195977856 X:110546905-110546927 GATGATGGTGACATACAGATGGG - Intergenic
1196914576 X:120519452-120519474 GATGATGGTGACATACAGATGGG + Intergenic
1197543054 X:127789760-127789782 GATGATGGTGACATACAGATGGG - Intergenic
1198070461 X:133143257-133143279 GCTGGTTGTGATAAACAGCTTGG + Intergenic
1198123856 X:133622142-133622164 GATGATGGTGACATACAGATGGG - Intronic
1198241941 X:134796291-134796313 GCTGCTGGGGACTGGCAGCTGGG + Intronic
1198689105 X:139260512-139260534 GATGATGGTGACATACAGATGGG - Intergenic
1199481636 X:148304867-148304889 GATGATGGTGACATACAGATGGG + Intergenic
1199484157 X:148330611-148330633 GATGATGGTGACATACAGATGGG + Intergenic
1199486281 X:148352049-148352071 GATGATGGTGACATACAGATGGG + Intergenic
1199856458 X:151762675-151762697 TATGCTGGTGACTCACTGCTAGG + Intergenic
1199911743 X:152294785-152294807 GATGATGGTGACATACAGATGGG + Intronic
1200390057 X:155935850-155935872 GATGATGGTGACATACAGATGGG + Intronic
1200871282 Y:8101588-8101610 GATGATGGTGACATACAGATTGG + Intergenic
1201171695 Y:11273149-11273171 GATGATGGTGACATACAGATGGG + Intergenic
1201393029 Y:13519456-13519478 GATGATGGTGACATACAGATGGG + Intergenic
1201494186 Y:14575739-14575761 GATGATGGTGACATACAGATGGG + Intronic
1201541912 Y:15114093-15114115 GATGATGGTGACATACAGATGGG - Intergenic
1201645202 Y:16223002-16223024 GATGATGGTGACATACAGATGGG + Intergenic
1201657611 Y:16362320-16362342 GATGATGGTGACATACAGATGGG - Intergenic
1201731954 Y:17213725-17213747 GATGATGGTGACAGACAGATGGG - Intergenic
1201974961 Y:19839241-19839263 GATGATGGTGACATACAGATGGG + Intergenic
1202166504 Y:21995278-21995300 GATGATGGTGACATACAGATGGG + Intergenic
1202224854 Y:22591095-22591117 GATGATGGTGACATACAGATGGG - Intergenic
1202318260 Y:23604565-23604587 GATGATGGTGACATACAGATGGG + Intergenic
1202552507 Y:26065492-26065514 GATGATGGTGACATACAGATGGG - Intergenic