ID: 1160895410

View in Genome Browser
Species Human (GRCh38)
Location 19:1399964-1399986
Sequence TCACTAGGTGGGGCGGGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160895399_1160895410 5 Left 1160895399 19:1399936-1399958 CCCCTGGGCAGACACAGGGCGCC 0: 1
1: 1
2: 2
3: 22
4: 169
Right 1160895410 19:1399964-1399986 TCACTAGGTGGGGCGGGCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 71
1160895401_1160895410 3 Left 1160895401 19:1399938-1399960 CCTGGGCAGACACAGGGCGCCTG 0: 1
1: 0
2: 3
3: 24
4: 279
Right 1160895410 19:1399964-1399986 TCACTAGGTGGGGCGGGCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 71
1160895398_1160895410 6 Left 1160895398 19:1399935-1399957 CCCCCTGGGCAGACACAGGGCGC 0: 1
1: 0
2: 2
3: 19
4: 185
Right 1160895410 19:1399964-1399986 TCACTAGGTGGGGCGGGCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 71
1160895389_1160895410 23 Left 1160895389 19:1399918-1399940 CCACCTCCAGGACCCGGCCCCCT 0: 1
1: 1
2: 5
3: 59
4: 622
Right 1160895410 19:1399964-1399986 TCACTAGGTGGGGCGGGCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 71
1160895393_1160895410 17 Left 1160895393 19:1399924-1399946 CCAGGACCCGGCCCCCTGGGCAG 0: 1
1: 1
2: 3
3: 48
4: 400
Right 1160895410 19:1399964-1399986 TCACTAGGTGGGGCGGGCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 71
1160895394_1160895410 11 Left 1160895394 19:1399930-1399952 CCCGGCCCCCTGGGCAGACACAG 0: 1
1: 1
2: 6
3: 52
4: 396
Right 1160895410 19:1399964-1399986 TCACTAGGTGGGGCGGGCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 71
1160895388_1160895410 24 Left 1160895388 19:1399917-1399939 CCCACCTCCAGGACCCGGCCCCC 0: 1
1: 1
2: 3
3: 35
4: 500
Right 1160895410 19:1399964-1399986 TCACTAGGTGGGGCGGGCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 71
1160895395_1160895410 10 Left 1160895395 19:1399931-1399953 CCGGCCCCCTGGGCAGACACAGG 0: 1
1: 0
2: 5
3: 50
4: 417
Right 1160895410 19:1399964-1399986 TCACTAGGTGGGGCGGGCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 71
1160895391_1160895410 20 Left 1160895391 19:1399921-1399943 CCTCCAGGACCCGGCCCCCTGGG 0: 1
1: 0
2: 3
3: 39
4: 397
Right 1160895410 19:1399964-1399986 TCACTAGGTGGGGCGGGCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 71
1160895400_1160895410 4 Left 1160895400 19:1399937-1399959 CCCTGGGCAGACACAGGGCGCCT 0: 1
1: 0
2: 1
3: 10
4: 162
Right 1160895410 19:1399964-1399986 TCACTAGGTGGGGCGGGCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 71
1160895386_1160895410 30 Left 1160895386 19:1399911-1399933 CCAAAGCCCACCTCCAGGACCCG 0: 1
1: 0
2: 2
3: 23
4: 289
Right 1160895410 19:1399964-1399986 TCACTAGGTGGGGCGGGCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160895410 Original CRISPR TCACTAGGTGGGGCGGGCTT AGG Intronic