ID: 1160895410

View in Genome Browser
Species Human (GRCh38)
Location 19:1399964-1399986
Sequence TCACTAGGTGGGGCGGGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160895401_1160895410 3 Left 1160895401 19:1399938-1399960 CCTGGGCAGACACAGGGCGCCTG 0: 1
1: 0
2: 3
3: 24
4: 279
Right 1160895410 19:1399964-1399986 TCACTAGGTGGGGCGGGCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 71
1160895399_1160895410 5 Left 1160895399 19:1399936-1399958 CCCCTGGGCAGACACAGGGCGCC 0: 1
1: 1
2: 2
3: 22
4: 169
Right 1160895410 19:1399964-1399986 TCACTAGGTGGGGCGGGCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 71
1160895386_1160895410 30 Left 1160895386 19:1399911-1399933 CCAAAGCCCACCTCCAGGACCCG 0: 1
1: 0
2: 2
3: 23
4: 289
Right 1160895410 19:1399964-1399986 TCACTAGGTGGGGCGGGCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 71
1160895395_1160895410 10 Left 1160895395 19:1399931-1399953 CCGGCCCCCTGGGCAGACACAGG 0: 1
1: 0
2: 5
3: 50
4: 417
Right 1160895410 19:1399964-1399986 TCACTAGGTGGGGCGGGCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 71
1160895388_1160895410 24 Left 1160895388 19:1399917-1399939 CCCACCTCCAGGACCCGGCCCCC 0: 1
1: 1
2: 3
3: 35
4: 500
Right 1160895410 19:1399964-1399986 TCACTAGGTGGGGCGGGCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 71
1160895393_1160895410 17 Left 1160895393 19:1399924-1399946 CCAGGACCCGGCCCCCTGGGCAG 0: 1
1: 1
2: 3
3: 48
4: 400
Right 1160895410 19:1399964-1399986 TCACTAGGTGGGGCGGGCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 71
1160895394_1160895410 11 Left 1160895394 19:1399930-1399952 CCCGGCCCCCTGGGCAGACACAG 0: 1
1: 1
2: 6
3: 52
4: 396
Right 1160895410 19:1399964-1399986 TCACTAGGTGGGGCGGGCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 71
1160895400_1160895410 4 Left 1160895400 19:1399937-1399959 CCCTGGGCAGACACAGGGCGCCT 0: 1
1: 0
2: 1
3: 10
4: 162
Right 1160895410 19:1399964-1399986 TCACTAGGTGGGGCGGGCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 71
1160895391_1160895410 20 Left 1160895391 19:1399921-1399943 CCTCCAGGACCCGGCCCCCTGGG 0: 1
1: 0
2: 3
3: 39
4: 397
Right 1160895410 19:1399964-1399986 TCACTAGGTGGGGCGGGCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 71
1160895398_1160895410 6 Left 1160895398 19:1399935-1399957 CCCCCTGGGCAGACACAGGGCGC 0: 1
1: 0
2: 2
3: 19
4: 185
Right 1160895410 19:1399964-1399986 TCACTAGGTGGGGCGGGCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 71
1160895389_1160895410 23 Left 1160895389 19:1399918-1399940 CCACCTCCAGGACCCGGCCCCCT 0: 1
1: 1
2: 5
3: 59
4: 622
Right 1160895410 19:1399964-1399986 TCACTAGGTGGGGCGGGCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160895410 Original CRISPR TCACTAGGTGGGGCGGGCTT AGG Intronic
901954601 1:12775170-12775192 TAACCAGGTGGGGAGGGCTCAGG + Intronic
903805758 1:26004591-26004613 CCACTAGGTTGGGTGGCCTTGGG - Intergenic
913430648 1:118787589-118787611 ACATTAGGAGGGGAGGGCTTTGG + Intergenic
915360789 1:155285305-155285327 TCGCGAGGTGGGGCTGGGTTGGG + Exonic
915955582 1:160217562-160217584 TACCTAGGTGGGGCAGGCTGGGG - Exonic
917359556 1:174160273-174160295 TCACAAGGTGGGTGGGGGTTGGG - Intronic
1069752651 10:70754019-70754041 TCAGGAGGTGGGAGGGGCTTGGG + Intronic
1070382009 10:75889785-75889807 TCTCCAGCTGGGGAGGGCTTGGG - Intronic
1070615668 10:77967698-77967720 TTACCAGGTGGAGGGGGCTTGGG - Intergenic
1073102563 10:101014314-101014336 TCTCTTGGTGTGGGGGGCTTGGG + Intronic
1073439036 10:103541552-103541574 TCACTAGCTGGGGTGAGCTGTGG + Intronic
1077158502 11:1102105-1102127 TCATTGGGTGGGGAGGGCCTGGG + Intergenic
1084013925 11:66367768-66367790 TCACCAGGTGAGGCAGGCTCAGG + Exonic
1085346198 11:75769399-75769421 TCACCAGGTAGAGCGAGCTTTGG + Intronic
1089603145 11:119627196-119627218 GCACTGGGTGGGGTAGGCTTGGG - Intronic
1090517706 11:127446532-127446554 TGAGGAGCTGGGGCGGGCTTGGG + Intergenic
1093390778 12:18617952-18617974 TCAGTAGGTGGGATGGGCTGTGG - Intronic
1103188977 12:118984212-118984234 TCACTGGATGTGGCTGGCTTGGG - Intronic
1112156894 13:96827319-96827341 TCACTATGTGGGAAGAGCTTAGG + Intronic
1114246895 14:20922547-20922569 TCACAAGGTGGAGAGGGCATGGG - Intergenic
1119376223 14:74195756-74195778 TCACTAGGTTTGGGGGGGTTCGG + Intronic
1126793084 15:52238586-52238608 TCAGTTGGTGGGGAGGGCTATGG - Intronic
1128510977 15:68313763-68313785 TCACCAGGTGGGCCGGGCTCCGG - Exonic
1129658652 15:77541081-77541103 ACAAGAGGTGGGGAGGGCTTTGG + Intergenic
1130398767 15:83529707-83529729 TCAGTGGGTGGGGCGGGGGTGGG + Intronic
1130705848 15:86232273-86232295 CCAGTAGGTTGGGCGGGCCTTGG + Intronic
1132516004 16:366360-366382 CCACCAGCTGGGGCTGGCTTAGG + Intergenic
1141600704 16:85124382-85124404 TCCCGAGGTGGGGCGGGCAGCGG - Intergenic
1145908738 17:28530670-28530692 TCACCAGGGGTGGGGGGCTTGGG + Intronic
1147743934 17:42683747-42683769 TCGCTAAGTGGGCCGGCCTTTGG + Intronic
1149461788 17:56834553-56834575 TCCCGAGGTGGGGCGGGTTGGGG + Intronic
1150264528 17:63823801-63823823 TCACCAGGTGAGGCGGCATTGGG - Exonic
1158560003 18:58505642-58505664 TCAGTAGTTGGGGTGGGCTGTGG - Intronic
1160895410 19:1399964-1399986 TCACTAGGTGGGGCGGGCTTAGG + Intronic
1162885018 19:13690540-13690562 TCTCTAGGTGGGACCAGCTTTGG - Intergenic
1163471037 19:17497162-17497184 TCCCTGGGTGGGGCGGTCTCGGG + Intronic
926253781 2:11172059-11172081 TCACATGGTGGGGAGGCCTTTGG + Intronic
927514174 2:23662429-23662451 TCAATAGATGGTGGGGGCTTTGG + Intronic
934777532 2:96948937-96948959 TTACTGGGGGGGGCGTGCTTGGG - Intronic
944141227 2:196459455-196459477 TCAGTAGGTTGGGGGGGCTTAGG - Intronic
946275381 2:218627873-218627895 ACACTAGGTGGGGCAAGTTTGGG + Intronic
1170960695 20:21023034-21023056 GCACTACCGGGGGCGGGCTTGGG - Intergenic
1172014177 20:31863180-31863202 TCTATAGGTGGGGTGGGGTTAGG + Intronic
1175349569 20:58309043-58309065 TCCCTGGGCGGGGCGGGCTGAGG - Intergenic
1175569810 20:60010175-60010197 TCACTGGGTGGGGCGGGGCGGGG + Intronic
1178632746 21:34276985-34277007 ACACCAGATGGGGCAGGCTTTGG + Intergenic
1181859188 22:25805153-25805175 TCACAACGTGGGGCTGGCATGGG - Intronic
1184687406 22:46102868-46102890 TCACCAGGTGTGAGGGGCTTTGG + Intronic
953079156 3:39599238-39599260 TCACTAGTTGGGCTGGTCTTGGG + Intergenic
962808726 3:138945006-138945028 CCACTAGGCGGGGCGGGGGTTGG - Exonic
966787900 3:183636697-183636719 TCACTAGGTGGGCCTGCCCTGGG + Intronic
976426344 4:84907584-84907606 TAACTAGGTGGCCCTGGCTTAGG - Intronic
986617019 5:9628241-9628263 TCAGTAGGTGGGTGGGGCTGGGG - Intergenic
991202090 5:64006499-64006521 TCAGTTGGTTGGGGGGGCTTTGG - Intergenic
991680840 5:69137822-69137844 TCACTAGATGGGGAGGGAGTGGG - Intergenic
1011874074 6:91934679-91934701 TGAATAGGTGGGGCAGGCTAGGG + Intergenic
1018033168 6:159860036-159860058 TCCCTAGGTGGGGTGGGGGTCGG - Intergenic
1019347080 7:536344-536366 GGACCAGGTGGGGCTGGCTTGGG - Intergenic
1023732983 7:43209849-43209871 TCACAAGATGGGCCGGGCATTGG + Intronic
1024013495 7:45290896-45290918 TCAGTTGGTTGGGGGGGCTTAGG + Intergenic
1032491576 7:132328153-132328175 TCACTGGGTCGGGCGGGCGCTGG + Intronic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1041514847 8:58689358-58689380 TGAATAAGTGTGGCGGGCTTTGG - Intergenic
1047467534 8:125132297-125132319 TCACTATGTTGGCCAGGCTTAGG + Intronic
1048553307 8:135454037-135454059 TCACTGAGTGGGGTGGGTTTGGG + Intergenic
1049567388 8:143348163-143348185 TCTCTGGATGGGGCGGGCCTGGG - Intronic
1049665187 8:143839870-143839892 CAGCTAGGTGGGGCGGGCATGGG - Intronic
1052986956 9:34494811-34494833 TCACTAGGTGGGGCTGGGGGAGG - Intronic
1060151966 9:121294525-121294547 GCACTAGGTGGGGCTGGCTCCGG + Intronic
1060546969 9:124467646-124467668 TCACCAGGTGGGGCGAGTTCTGG + Intronic
1061009061 9:127944599-127944621 CCACCAGGTAGGGCAGGCTTAGG - Exonic
1061876175 9:133545256-133545278 TCCCTTTATGGGGCGGGCTTGGG + Intronic
1194930415 X:99880935-99880957 TCACTGGGTGGGGCCTTCTTTGG + Intergenic
1198854055 X:140996970-140996992 ACAAAAGGTGGGGAGGGCTTGGG + Intergenic
1198877958 X:141248145-141248167 ACAAAAGGTGGGGAGGGCTTGGG - Intergenic