ID: 1160896128

View in Genome Browser
Species Human (GRCh38)
Location 19:1402689-1402711
Sequence TGAGGTTCACAGGTTGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160896121_1160896128 13 Left 1160896121 19:1402653-1402675 CCATTTAACACGAGGGAAACTGA No data
Right 1160896128 19:1402689-1402711 TGAGGTTCACAGGTTGCAGCAGG No data
1160896120_1160896128 14 Left 1160896120 19:1402652-1402674 CCCATTTAACACGAGGGAAACTG No data
Right 1160896128 19:1402689-1402711 TGAGGTTCACAGGTTGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160896128 Original CRISPR TGAGGTTCACAGGTTGCAGC AGG Intergenic
No off target data available for this crispr