ID: 1160896913

View in Genome Browser
Species Human (GRCh38)
Location 19:1407479-1407501
Sequence CTCAGGGACGCACGCACAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160896906_1160896913 4 Left 1160896906 19:1407452-1407474 CCCCGACTGCGGCGGCGCGAAAT 0: 1
1: 0
2: 0
3: 0
4: 5
Right 1160896913 19:1407479-1407501 CTCAGGGACGCACGCACAGACGG 0: 1
1: 0
2: 2
3: 12
4: 141
1160896907_1160896913 3 Left 1160896907 19:1407453-1407475 CCCGACTGCGGCGGCGCGAAATC 0: 1
1: 0
2: 0
3: 1
4: 77
Right 1160896913 19:1407479-1407501 CTCAGGGACGCACGCACAGACGG 0: 1
1: 0
2: 2
3: 12
4: 141
1160896908_1160896913 2 Left 1160896908 19:1407454-1407476 CCGACTGCGGCGGCGCGAAATCC 0: 1
1: 0
2: 0
3: 0
4: 3
Right 1160896913 19:1407479-1407501 CTCAGGGACGCACGCACAGACGG 0: 1
1: 0
2: 2
3: 12
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160896913 Original CRISPR CTCAGGGACGCACGCACAGA CGG Intergenic
900074584 1:802826-802848 CTCAGCGACGCCAGCACTGATGG + Intergenic
900330706 1:2133211-2133233 CTGAGGGACTGACGCACAGCTGG - Intronic
900330821 1:2133628-2133650 CCGAGGGACGGACGCACAGCCGG - Intronic
900424459 1:2569683-2569705 CTCAGGGAGGCATCCGCAGAGGG + Intergenic
900926161 1:5707497-5707519 ATCAGAGACACACACACAGAGGG + Intergenic
904310902 1:29628938-29628960 CTCTGGGATGCAGACACAGAAGG + Intergenic
904383663 1:30127873-30127895 CTCAGGGACGGACACCCTGATGG - Intergenic
904470480 1:30732645-30732667 CACAGGGAAGCAGGCACAGGAGG + Exonic
908154125 1:61335146-61335168 CTCTGGGACTCACTCACACATGG + Intronic
915479474 1:156175186-156175208 CTCAGGGTCCCAGGCACAGTGGG - Exonic
916169839 1:161993665-161993687 CCCAGGTACGCCAGCACAGATGG - Intronic
919148449 1:193664326-193664348 CACAGGGATGCAGGCACAGATGG + Intergenic
920034498 1:203057025-203057047 CCCTGGGACGCAGGCAGAGAAGG - Intronic
920045257 1:203128491-203128513 CACACAGACACACGCACAGAGGG - Intronic
920639532 1:207738590-207738612 CACAGTGACGCACACAAAGAGGG - Intergenic
922270431 1:224027732-224027754 CTCAGCGACGCCAGCACTGATGG + Intergenic
924406262 1:243750430-243750452 CACACGCACGCACGCACACACGG + Intronic
1063127834 10:3151019-3151041 CTCAGGAACACACACACACACGG + Intronic
1063816655 10:9782922-9782944 CTCAGGGAGGAACATACAGAAGG + Intergenic
1066508176 10:36066575-36066597 CTCAGGGAGGGAGGCCCAGAGGG + Intergenic
1067055009 10:43045166-43045188 CCCAGGGACACACGCAGAGGTGG + Intergenic
1068777451 10:60883467-60883489 GTCAGGAACGCAGGCACAAAGGG - Intronic
1069984474 10:72274070-72274092 CTCTAGGACCCACACACAGAAGG - Intronic
1070438352 10:76415690-76415712 GTCAGGAATGCACGCACATATGG - Intronic
1070672461 10:78387726-78387748 CTGAGGGAGGGACTCACAGAGGG + Intergenic
1073561281 10:104498908-104498930 CCCTGGGGCGCACACACAGAAGG - Intergenic
1074752646 10:116601626-116601648 ATCAGGGATGCACAGACAGAGGG - Intronic
1076381204 10:130025519-130025541 ACCAGGGATGCATGCACAGAGGG + Intergenic
1079308671 11:19345785-19345807 CTCAGGCACGTACGCCCAGAGGG - Intergenic
1080905316 11:36539210-36539232 ACCAGGGATGCATGCACAGAGGG + Intronic
1081685230 11:45037805-45037827 CTCAGGGTAGCATGCCCAGAGGG - Intergenic
1084351232 11:68601293-68601315 CTCAGAGACGTGCACACAGAGGG - Intronic
1085526371 11:77166528-77166550 CTCAGAGAAGCTGGCACAGAGGG + Intronic
1085606258 11:77902115-77902137 CACTGGGAGGCAAGCACAGAAGG - Intronic
1090227727 11:125081712-125081734 CACATGGACGCACCCACAGCAGG + Intronic
1090402799 11:126459714-126459736 CACATGGACACACGCACACACGG - Intronic
1091287575 11:134416317-134416339 CACAGGAAAGCATGCACAGATGG - Intergenic
1091331911 11:134737081-134737103 GACAGGGACGCAGGCAGAGAGGG - Intergenic
1096072998 12:48786229-48786251 CCCAGGGACCCACACGCAGAAGG + Intronic
1096088794 12:48884371-48884393 ATCAGGCACGCACTCACAGCCGG + Intergenic
1099192764 12:79577238-79577260 CTCAGGGATGCAAGCAAAGATGG + Intronic
1101334126 12:103781393-103781415 GCCAGGGACGCATGCCCAGAGGG + Intronic
1101860084 12:108475605-108475627 CTCAGGCAAGGAAGCACAGATGG - Intergenic
1102295550 12:111733794-111733816 CTCAGGCACCCGGGCACAGAGGG + Intronic
1102352136 12:112200847-112200869 CACACGCACGCACGCACACATGG - Intronic
1102526333 12:113514942-113514964 CTCAGGGACCAGCGCACAGAGGG + Intergenic
1103714903 12:122939395-122939417 CTCAGGGGTGCACACAGAGATGG + Intronic
1104069826 12:125334914-125334936 TCCAGGGCCGCACGCTCAGAAGG - Intronic
1104922023 12:132295543-132295565 CACAGAGACACACGCAGAGAAGG + Intronic
1109262278 13:60158717-60158739 CTCAGGCAGGCAAGCACTGAAGG + Intronic
1113807747 13:113119502-113119524 CACACGGATGCACACACAGATGG + Exonic
1114570197 14:23661393-23661415 CTGAGGGATGCACTTACAGATGG - Intergenic
1117368305 14:55052187-55052209 TTTAGGGACGCACGAACAAAGGG - Intronic
1121472814 14:94168694-94168716 ATCAGGGAGGGACACACAGAGGG - Intronic
1121690263 14:95873229-95873251 CTCAGGGAGGCAAGTAGAGAGGG - Intergenic
1121888100 14:97563057-97563079 CTCAGGGAAGGATGCACGGATGG - Intergenic
1122840963 14:104462297-104462319 CTCCGGCACCCACGCACAGTCGG - Intergenic
1124231826 15:27952526-27952548 GGCAGGGAAGCACGCACAGATGG + Intronic
1124232140 15:27954880-27954902 GTCAGGGACACCCGCTCAGAGGG + Intronic
1131055240 15:89371079-89371101 CTCACGGAAGGTCGCACAGAAGG + Intergenic
1132315464 15:100887012-100887034 CTCAGGGACCCAAGTACGGAAGG - Intronic
1132798383 16:1738168-1738190 CTCACGGACGCTCACACGGACGG - Intronic
1136505225 16:30698699-30698721 CTCAGGCACGCGTGCGCAGAAGG - Intronic
1137269043 16:46890781-46890803 CTCAGGCGCACACTCACAGATGG - Intronic
1141761668 16:86032803-86032825 CTCAGGGACTCACTCTCCGAGGG + Intergenic
1142046267 16:87927095-87927117 CGCAGCGACGCACGCCCACAGGG + Intronic
1144236209 17:13262797-13262819 CACAGGGACCCATGCTCAGAAGG - Intergenic
1144295771 17:13873589-13873611 CACAGGGAGACACACACAGAGGG + Intergenic
1147158628 17:38558403-38558425 CTGCGGGACGCACGGACGGATGG + Intronic
1147439103 17:40436615-40436637 CTTAGAGACGCCCCCACAGAGGG - Intergenic
1151255495 17:72873322-72873344 CTCAGGGATGAAATCACAGAGGG - Intronic
1152723697 17:81935036-81935058 CACAGGCACGCACGCCCAGGTGG - Exonic
1152947216 17:83204578-83204600 CACAGGGACTCACGCACAGAGGG + Intergenic
1153046149 18:857219-857241 CTCAGGGTCTCAAACACAGATGG + Intergenic
1153733844 18:8044059-8044081 CTCAGGCAGGCACTCTCAGAGGG + Intronic
1153776720 18:8460950-8460972 CCCAGGGACACAGGCCCAGAAGG + Intergenic
1155711859 18:28890983-28891005 CTCAGACACGCACACACACAGGG + Intergenic
1160896913 19:1407479-1407501 CTCAGGGACGCACGCACAGACGG + Intergenic
1160942015 19:1624692-1624714 CTCACGGACGTGCGCACAGTGGG + Intronic
1161769485 19:6223545-6223567 CTCGAGGAAGCAGGCACAGATGG - Intronic
1165954916 19:39496485-39496507 CTGAGGGAGGCACAGACAGAGGG + Intergenic
1167245064 19:48368195-48368217 CTCAGGGTCACACGGACACAGGG - Intronic
1167604976 19:50476795-50476817 CTCAGTCACGCACGCGCAGGAGG + Intronic
1167724248 19:51200005-51200027 CTCAGGGACGGCAGCACAGGTGG + Intergenic
925780533 2:7377922-7377944 CTGAGGTATGCACACACAGAGGG - Intergenic
925908211 2:8552292-8552314 CTCAGCAGCACACGCACAGAGGG + Intergenic
928395868 2:30942981-30943003 CTCAGAGACAGACACACAGAAGG + Intronic
929896933 2:45968865-45968887 CTCAGGGACTCAGGGAGAGATGG - Intronic
937092832 2:119217904-119217926 TTCATGGACACACACACAGAAGG - Intergenic
937874264 2:126809456-126809478 CTCAGGGATGCAGGGCCAGAGGG + Intergenic
946409538 2:219509231-219509253 CTCTGGGAAGCAGGCACAGCTGG + Intergenic
946682620 2:222233182-222233204 CTCAGGGCCACACACTCAGAAGG - Intronic
947629160 2:231640736-231640758 CACAGGGACGCACCCACATTGGG - Intergenic
1168878109 20:1185120-1185142 CACAGGTACGCACGCGGAGAGGG - Intronic
1172421983 20:34825538-34825560 CTGACGGACGGACGCACCGAGGG - Intronic
1173441983 20:43085900-43085922 CTAAGGGACAAACACACAGAAGG + Intronic
1174498711 20:50968399-50968421 CACAGGGCCGCATGCTCAGAGGG - Intergenic
1175215976 20:57391887-57391909 CTCCGGGGCACACGCCCAGACGG + Intronic
1175392562 20:58636307-58636329 CTCTGTAACACACGCACAGAGGG - Intergenic
1179731021 21:43367553-43367575 CTCAGGGCCGGAAGCACAGCTGG + Intergenic
1180022947 21:45140615-45140637 CTCACGCACACACACACAGATGG - Intronic
1180067300 21:45418815-45418837 CGCAGGGCCGCAGGCACAGGAGG - Intronic
1182354999 22:29718957-29718979 TTCAGGGAAGCACCCAGAGATGG + Intergenic
950954745 3:17040181-17040203 CTCAGGGTCTCACACATAGAGGG + Intronic
953878307 3:46678865-46678887 CTCAGGGAGGCACACACTGAAGG + Intronic
960853184 3:122077066-122077088 ATCAGGGAGGCATGCCCAGAGGG + Intronic
967705909 3:192650459-192650481 CTCAGGGAAGCTCATACAGATGG - Intronic
968572264 4:1347944-1347966 CCCAGAGAGGCACCCACAGATGG + Intronic
969268276 4:6080388-6080410 CTCAGGGGTGCAGGGACAGAAGG + Intronic
969297784 4:6279862-6279884 CTCAGGGAGGCAACCAGAGAAGG - Intronic
970925913 4:21452105-21452127 CACAGGGACGTAGGCACTGAGGG + Intronic
971276947 4:25207559-25207581 ATCAGGAAGGCATGCACAGAAGG + Intronic
976192581 4:82502115-82502137 GTCATGGACGCACTCACAGAGGG + Intronic
977780138 4:100971301-100971323 ATCAAGCACGCAGGCACAGAAGG + Intergenic
983134121 4:164058459-164058481 CTCAGGGATTCATGCTCAGAAGG + Intronic
985330165 4:188823321-188823343 CACAGGGATGCACACACACACGG + Intergenic
985330174 4:188823395-188823417 CACAGGGACGCACACAAACAGGG + Intergenic
985330215 4:188823702-188823724 CACAGGGATGCACACACAGGAGG + Intergenic
985330244 4:188823932-188823954 CACAGGGAAGCGCGCACACAGGG + Intergenic
985330246 4:188823948-188823970 CACAGGGACGCACACACACAGGG + Intergenic
985330257 4:188824079-188824101 GACAGGGACGCACACACATAGGG + Intergenic
985330262 4:188824125-188824147 CACAGGGAAGCACACACACAGGG + Intergenic
985330264 4:188824141-188824163 CACAGGGAAGCACACACACAGGG + Intergenic
985330270 4:188824189-188824211 CACAGGGATGCACACACACAGGG + Intergenic
985330285 4:188824291-188824313 CACAGGGACGCACACACAGAGGG + Intergenic
985330294 4:188824349-188824371 CACAGGGAGGCACACACACAGGG + Intergenic
985330303 4:188824423-188824445 CACAGGGATGCACACACACAGGG + Intergenic
985330345 4:188824717-188824739 CACAGGGACGCACAGACACAGGG + Intergenic
985778323 5:1856939-1856961 CTCAGGGACCCCCACCCAGAGGG + Intergenic
986025187 5:3843980-3844002 CTCAGCGACACACACTCAGACGG - Intergenic
986248464 5:6032374-6032396 ATCAGGGACACACACACAGGAGG + Intergenic
987026244 5:13929698-13929720 CTCAGGCTCTCAAGCACAGAGGG - Intronic
988214367 5:28252034-28252056 CTCAGAGAAGCAAGCAAAGAAGG - Intergenic
997187995 5:131901164-131901186 CACATGAATGCACGCACAGATGG + Intronic
999070148 5:148736040-148736062 CACAGGGACCCACACTCAGAGGG - Intergenic
1001244000 5:170092177-170092199 CACAGGCACACACGCAGAGAAGG - Intergenic
1002261348 5:177995790-177995812 CTCAGGGACCCACGCACACCGGG + Intronic
1002298968 5:178247020-178247042 CCCAGGGAGGCAGACACAGAAGG - Intronic
1002634117 5:180598731-180598753 CTCAGGGGCGCATCCAAAGAGGG - Intergenic
1013797279 6:113901734-113901756 CTCAGGCACACCCCCACAGAAGG + Intergenic
1021692750 7:23246827-23246849 CTCACGGACGCAGGCACTCAAGG - Exonic
1026102251 7:67392986-67393008 ATCAAGGACGCAGGCACACAAGG - Intergenic
1035548988 8:505662-505684 CTCAGTGAAGCACTGACAGATGG - Intronic
1043407309 8:79951083-79951105 CTCAGGGCCTCATGCACAGAAGG + Intronic
1043861269 8:85319992-85320014 TTCATGCACGCACGCACACACGG - Intergenic
1047791116 8:128204947-128204969 CTCTGAGAAGCACACACAGAGGG + Intergenic
1048290562 8:133178279-133178301 CTCAGGGGCGTACACACAGAAGG + Intergenic
1049818573 8:144620515-144620537 CTCAGGGACACAGGCTCACACGG - Intergenic
1056824062 9:89864602-89864624 CTCAGGACCACACACACAGAGGG + Intergenic
1061594849 9:131622105-131622127 CTCAGAGAGGGACGAACAGACGG + Intronic
1186798138 X:13066510-13066532 CTCTGGGGAGCACGCAGAGAGGG - Intergenic
1193956889 X:87874461-87874483 CTCAGGCATGCACGCTAAGAGGG - Intergenic
1195036524 X:100975156-100975178 CTCAGGGACCAACTCATAGAGGG - Intronic
1195696744 X:107673121-107673143 CGCACGCACGCACGCACACACGG - Intergenic
1197777094 X:130125574-130125596 GTCAGGGAAGGACGTACAGAAGG + Intergenic
1201964219 Y:19714105-19714127 CACATGGACGCACGCATAGAGGG + Intronic