ID: 1160897059

View in Genome Browser
Species Human (GRCh38)
Location 19:1407945-1407967
Sequence CGGCTTCGCGCCGGGGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 165}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160897038_1160897059 28 Left 1160897038 19:1407894-1407916 CCCCGTCAAGGTCACGCCGGCCG 0: 1
1: 0
2: 0
3: 3
4: 32
Right 1160897059 19:1407945-1407967 CGGCTTCGCGCCGGGGGCCCTGG 0: 1
1: 0
2: 0
3: 16
4: 165
1160897039_1160897059 27 Left 1160897039 19:1407895-1407917 CCCGTCAAGGTCACGCCGGCCGG 0: 1
1: 0
2: 0
3: 4
4: 23
Right 1160897059 19:1407945-1407967 CGGCTTCGCGCCGGGGGCCCTGG 0: 1
1: 0
2: 0
3: 16
4: 165
1160897041_1160897059 26 Left 1160897041 19:1407896-1407918 CCGTCAAGGTCACGCCGGCCGGG 0: 1
1: 0
2: 1
3: 3
4: 31
Right 1160897059 19:1407945-1407967 CGGCTTCGCGCCGGGGGCCCTGG 0: 1
1: 0
2: 0
3: 16
4: 165
1160897052_1160897059 -10 Left 1160897052 19:1407932-1407954 CCCGGACTCGCCGCGGCTTCGCG 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1160897059 19:1407945-1407967 CGGCTTCGCGCCGGGGGCCCTGG 0: 1
1: 0
2: 0
3: 16
4: 165
1160897048_1160897059 12 Left 1160897048 19:1407910-1407932 CCGGCCGGGGGCGGACTCGGGAC 0: 1
1: 0
2: 0
3: 16
4: 110
Right 1160897059 19:1407945-1407967 CGGCTTCGCGCCGGGGGCCCTGG 0: 1
1: 0
2: 0
3: 16
4: 165
1160897049_1160897059 8 Left 1160897049 19:1407914-1407936 CCGGGGGCGGACTCGGGACCCGG 0: 1
1: 0
2: 2
3: 15
4: 135
Right 1160897059 19:1407945-1407967 CGGCTTCGCGCCGGGGGCCCTGG 0: 1
1: 0
2: 0
3: 16
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160897059 Original CRISPR CGGCTTCGCGCCGGGGGCCC TGG Intronic
901086145 1:6613543-6613565 AGGCTCCGCGGCGGCGGCCCCGG - Intronic
901201127 1:7467993-7468015 CGGCTTCGGGCTGAGAGCCCTGG + Intronic
901551345 1:9997799-9997821 CGGGAGCGCGCCCGGGGCCCCGG - Intronic
902336853 1:15758953-15758975 GGGCGCCGCGCCGGGGGTCCCGG - Intronic
903950542 1:26993807-26993829 CGCCTGCGGCCCGGGGGCCCAGG + Exonic
904252998 1:29237858-29237880 CGGCTGCGCCCCGGGCGGCCGGG + Intronic
905108227 1:35576671-35576693 CGGCTTCGGACCGGGGTTCCGGG - Intronic
906525225 1:46489775-46489797 CGGGCCCGCGCCGGGCGCCCGGG + Intergenic
908474015 1:64470834-64470856 CGGCTTCGGCCCCGGCGCCCAGG - Exonic
911601193 1:99849998-99850020 CGGCTCCGGGCCGGGGGACCTGG - Intergenic
915319944 1:155051188-155051210 CCGCTGCGCGCCGGGTGCCTCGG - Intronic
916414036 1:164576388-164576410 CGGCGCCGCGCCGGCGGACCGGG - Intronic
920218416 1:204377800-204377822 CGGCGTCGCTCCCGGGTCCCTGG + Intergenic
922959960 1:229637916-229637938 CTGCTCAGTGCCGGGGGCCCGGG + Exonic
1065367873 10:24952712-24952734 CTGCTTCCCGCCGGCGGGCCCGG - Intergenic
1065883761 10:30059282-30059304 AGGCACCGCGCGGGGGGCCCAGG + Intronic
1071695287 10:87863508-87863530 CGCCGCCGCGCCGGGAGCCCGGG - Exonic
1074866596 10:117547534-117547556 CCTCTTCGTGGCGGGGGCCCTGG - Intronic
1075144600 10:119872579-119872601 CGGCATCTCGCCAGGGGCCGGGG + Exonic
1077051342 11:568351-568373 CGGCCCCGCGCCGGGGTCGCAGG - Intergenic
1077081416 11:726181-726203 CTGCTTCGAGGCGGGGGTCCCGG + Intronic
1082821227 11:57545976-57545998 CTGCTCGGCCCCGGGGGCCCCGG + Exonic
1083312741 11:61793068-61793090 CCGCTTGGCGCTGGGGGCCGTGG + Intronic
1083317746 11:61827134-61827156 CGGCTTAGTGCCGGGCGTCCTGG - Intronic
1083571083 11:63762773-63762795 GGGCTACGCGCCCGGGGCCCGGG - Exonic
1084516024 11:69638373-69638395 CGGCTGCGCGCCGCGGGGCTCGG - Intergenic
1085353543 11:75815786-75815808 CGGCCTCGGGCCGGGGCCCCAGG - Intronic
1088893963 11:114064138-114064160 CTGCTTCGAGTCGGGGTCCCAGG - Exonic
1090286589 11:125505052-125505074 AGGCTTGGCGCGGGGGTCCCCGG + Intergenic
1090636724 11:128694397-128694419 CGGCTTCGCGCCGGCTCCTCCGG + Intronic
1091778723 12:3200713-3200735 CCGCTTCTGGCCGGCGGCCCCGG - Intronic
1092297209 12:7210070-7210092 CTCCTTCACCCCGGGGGCCCCGG - Exonic
1093435473 12:19130207-19130229 CTGCCCCGCGCCGCGGGCCCCGG + Intronic
1096253784 12:50050911-50050933 CGGCCCAGCGCCGGGGCCCCGGG + Intergenic
1096459467 12:51814332-51814354 CCGCGGCGCGCCGGGGGCGCGGG + Intergenic
1102517996 12:113463137-113463159 CTGCTTCGGGGCGGGGCCCCCGG + Exonic
1102997380 12:117360959-117360981 CGGCCTCAGGCCGGGGGCTCCGG - Intronic
1104012199 12:124939802-124939824 AGGCTCCGCGCCGGGCACCCTGG + Intergenic
1104930412 12:132336575-132336597 CGGCTCTGCGCCTGGGGCCCGGG + Intergenic
1104930429 12:132336618-132336640 CGGCTCTGCTCCTGGGGCCCGGG + Intergenic
1107695029 13:42991937-42991959 TGGCTTCGGGGCGGGAGCCCGGG - Intronic
1109284793 13:60397438-60397460 CGGGTGCGGGCCGGGGCCCCAGG + Intronic
1113695599 13:112343272-112343294 CGGCCTGGCCCCGCGGGCCCAGG - Intergenic
1114483258 14:23048078-23048100 CGGCTTCGCTGCCGGAGCCCAGG + Exonic
1115852406 14:37598656-37598678 CGGCCTCGGGCCTCGGGCCCCGG + Intronic
1116186798 14:41608299-41608321 CGGCTCCGCGCCCGGGGAGCGGG - Exonic
1116950184 14:50872217-50872239 CAGCTACGGGCTGGGGGCCCGGG - Exonic
1118797132 14:69153378-69153400 CCGCTTCCCGCCTGGGGACCTGG + Intergenic
1120788018 14:88554710-88554732 CGGCCGCGCGGCGGGGCCCCGGG - Exonic
1123041139 14:105490677-105490699 GGACTTCGCGCCAGGGGCCAGGG + Intronic
1124190834 15:27574822-27574844 CGGCTCCCAGCCTGGGGCCCGGG - Intergenic
1125674259 15:41494088-41494110 CCGCTTGGCCCCGCGGGCCCGGG - Exonic
1128767935 15:70262445-70262467 GGCCTTGGCCCCGGGGGCCCAGG + Intergenic
1130546095 15:84858307-84858329 CGGTTTCCCCCCGGGGGCCCAGG + Exonic
1130966998 15:88705241-88705263 CGGCTCCGCGCCGCCAGCCCGGG - Intergenic
1132163732 15:99565624-99565646 CGGCTTGGCGCCGGGGCCGCGGG - Intronic
1132338536 15:101064045-101064067 AGGCTTCGCGCTGGCGGCCTTGG - Intronic
1132419308 15:101652093-101652115 CGGCCTCGGGCCGGGCGGCCAGG + Intronic
1132743872 16:1428780-1428802 GAGCTTCCGGCCGGGGGCCCTGG - Intergenic
1133029692 16:3004485-3004507 CAGATGCGCGCCGGGGCCCCAGG - Intergenic
1134849787 16:17470593-17470615 CGGCCCCGCGCCGGGAGCGCCGG - Exonic
1142989970 17:3723940-3723962 CGGCTTCGCTCCCGGGACCTGGG + Exonic
1143106501 17:4533016-4533038 CTCCTTCGCCACGGGGGCCCTGG + Exonic
1143478152 17:7214580-7214602 CCGCTTCGCTCCTGGGGCTCTGG + Intronic
1144764230 17:17724217-17724239 CGGCGGCGGGCCGGGGGCTCGGG - Intronic
1144852570 17:18251442-18251464 CACCTTCCCGCTGGGGGCCCGGG + Exonic
1145094075 17:20009569-20009591 CGTCTTCGCCGCGGGGGCCCCGG + Intronic
1146762421 17:35490092-35490114 CTGCTCCGCGCCTGGGGCACTGG - Intronic
1146957092 17:36942253-36942275 AGGCGTGGCGCCGGGCGCCCAGG - Exonic
1147662264 17:42123033-42123055 CGGCTTCGCCCCGGAGGAACTGG + Exonic
1149682266 17:58514657-58514679 CGCCTTCCCGCCGCGGTCCCGGG - Intronic
1150239845 17:63622639-63622661 TGGCTCCGCGCGGGGGGCGCGGG - Exonic
1150239864 17:63622683-63622705 GGGCTGCATGCCGGGGGCCCGGG - Exonic
1151314209 17:73311835-73311857 CGCCTTCGCGCTGGGTGCCCTGG - Intronic
1151969787 17:77451646-77451668 CGGCCTCGGGCCGGGGCCCAGGG - Intronic
1152740342 17:82015924-82015946 CAGCCTCCAGCCGGGGGCCCAGG - Intronic
1153238941 18:3013431-3013453 GGGCTGCGCGCCCGGGCCCCTGG + Intergenic
1153794458 18:8609656-8609678 CGGCTGCGCGCCCCGGGCCCCGG - Exonic
1157529450 18:48409198-48409220 CGGCTTCGCGCGCCGGGCTCGGG - Intronic
1160436753 18:78857741-78857763 CGGCTCCGCGCCGGCTTCCCCGG + Intergenic
1160557669 18:79736500-79736522 CGGCAGGGGGCCGGGGGCCCAGG + Exonic
1160766922 19:812854-812876 CGGCTACGAGCTGGGGGACCTGG - Exonic
1160897059 19:1407945-1407967 CGGCTTCGCGCCGGGGGCCCTGG + Intronic
1160907224 19:1457021-1457043 GGGGGTCGCGCCGGGGCCCCAGG + Exonic
1161973485 19:7596387-7596409 CAGCTCCGCGCGGGGGTCCCCGG + Intronic
1163158155 19:15449971-15449993 CGGCGGCGCGCCGGGGGGGCGGG - Intergenic
1163159759 19:15457596-15457618 CGGCTGCGCGGCTTGGGCCCGGG - Exonic
1163469134 19:17486764-17486786 GGGCTTCGCGCCGGGCGACGTGG + Exonic
1163824331 19:19514600-19514622 CGGCTTCTAGCCGGAGTCCCCGG + Exonic
1163824332 19:19514610-19514632 TGGCTGCGCGCCGGGGACTCCGG - Exonic
1165871362 19:38975673-38975695 CGGCGTGGCCCAGGGGGCCCCGG + Exonic
1167517102 19:49929821-49929843 CGGCTCTGCGCCGAGGGCCAAGG - Intronic
1167564687 19:50248989-50249011 TGACTTCGCGCTGGAGGCCCTGG + Exonic
1168336447 19:55600126-55600148 CGCCTGCGCACCGGCGGCCCTGG - Intronic
1168694498 19:58396859-58396881 CGGCGTCCAGGCGGGGGCCCAGG - Exonic
925176928 2:1792580-1792602 AGGCTTCGGGCCGGGCGCCGTGG + Intronic
932191137 2:69742191-69742213 GGGCTCCGGGCCGGGGGTCCTGG + Intronic
934893013 2:98087204-98087226 AGGCTGCGCGCCGGGGGCGAAGG - Exonic
938547480 2:132347720-132347742 CCACTTAGCGCCGGGGGTCCGGG + Intergenic
940420896 2:153478427-153478449 CGGCTTCGCGGAGGGAGGCCCGG - Exonic
941102170 2:161308427-161308449 GTGCTTCGCGGCGGAGGCCCGGG + Exonic
944413476 2:199463086-199463108 CGGCCGCGGGCCGGGGGACCGGG + Intronic
944547561 2:200812420-200812442 GCGCTTTGCGCCGGGGCCCCAGG - Exonic
948840492 2:240646477-240646499 CGGCTTCGGGCTGGGTGTCCTGG + Intergenic
948849976 2:240701136-240701158 CGGCCTCGCGCGGCAGGCCCAGG - Intergenic
948933734 2:241149322-241149344 CGGCTCCGCGCCCCTGGCCCAGG - Intronic
1173548104 20:43914691-43914713 CTGCCTAGGGCCGGGGGCCCGGG - Intergenic
1173631778 20:44521762-44521784 CGGATTTGCGTCTGGGGCCCCGG + Intronic
1175975669 20:62709219-62709241 CAGCTCCGCGCCGGGAACCCCGG + Exonic
1176005707 20:62861373-62861395 CGGCTTCGCGGCGGGCGGTCAGG - Exonic
1176125360 20:63472541-63472563 CGGCTCCCGGCCGGGGGGCCTGG - Exonic
1176222147 20:63974775-63974797 TGGCTCCGCGCCCAGGGCCCAGG - Exonic
1176952539 21:15064545-15064567 CGGGTTCTCGCGGGGGGCCGGGG - Intronic
1180921652 22:19524468-19524490 CTGCTTCGGGCCGGGGGGCCGGG - Exonic
1184679307 22:46061760-46061782 AGGGTTCGAGCCGGGGTCCCAGG - Intronic
1185320733 22:50199262-50199284 CCCCTTCGCTCCGGGGGCTCAGG - Exonic
1185344954 22:50307100-50307122 CTGCTTGGCGCGGGGGGACCAGG - Intronic
954256615 3:49411844-49411866 CCTCTTCGCGCCGGGGACGCCGG + Exonic
956605080 3:71065361-71065383 CGGCTTGGCGCCGCGAGCGCCGG - Intronic
956761369 3:72447439-72447461 CGGCTTCGGGGCCGGGGTCCCGG - Intergenic
961453150 3:127011615-127011637 AGGCTCTGCGCTGGGGGCCCAGG - Intronic
962265749 3:133943070-133943092 CAGCTTGGAGCCAGGGGCCCAGG + Intronic
963133308 3:141877221-141877243 CGGCTTCGGGCAGGGGTCCCCGG - Intronic
966595156 3:181719430-181719452 CGGCCTCCCGCCGGCTGCCCTGG + Intergenic
966866761 3:184262466-184262488 CGGCGTCGCGGGGGGCGCCCTGG + Intronic
967859486 3:194140889-194140911 CGGATGCGGGCCGCGGGCCCCGG + Intergenic
969071370 4:4542012-4542034 CGGGTTCGCGCCGCGGTCGCCGG - Exonic
969239740 4:5890438-5890460 GGGCTTCGCAACGGGTGCCCCGG - Intronic
974003127 4:56530563-56530585 GGGCTGGGCGCGGGGGGCCCCGG + Intergenic
975779060 4:77819927-77819949 GGCCTTCGCGCCGGCGGCCGCGG - Intergenic
979624273 4:122827588-122827610 CGGCTCCGGGCCGGGGGTACTGG - Intronic
992102367 5:73419750-73419772 CGGCTTCTTGCGGGCGGCCCGGG + Intergenic
992690458 5:79236335-79236357 CGGCCTCGCGCGGGGGGCGGCGG + Exonic
994171354 5:96662455-96662477 CGGCTGCTCGCCGGGGCCGCGGG - Exonic
994175117 5:96702719-96702741 CGGCCCCGCCCCGGGAGCCCGGG - Intronic
996329411 5:122312262-122312284 CGCCGGCGCGCCGGGCGCCCCGG + Exonic
996785074 5:127229414-127229436 CGTCCTCGCGCCGGCGACCCTGG + Intergenic
998406601 5:141878012-141878034 CGGCTTCTCGCCGCGGACCTGGG + Intronic
999768134 5:154755924-154755946 CGGCTTGGCGCAGGGCGGCCGGG - Intronic
1002714412 5:181217523-181217545 CGGCTTCGGGCCGTGGGACGCGG - Intergenic
1002922793 6:1585105-1585127 CGGCTTCCCCCAGGGGCCCCTGG + Intergenic
1003084961 6:3053693-3053715 CGGCTCCGCCCTGGGGGACCAGG + Intergenic
1003136478 6:3438424-3438446 CTGGTTCCCGCCAGGGGCCCAGG - Intronic
1004924087 6:20402489-20402511 CTGCTCCGCGCCGGGGGCACTGG - Exonic
1006770301 6:36547422-36547444 CGTCTCCGCGGCGGGGGACCGGG - Exonic
1008956510 6:57221908-57221930 CAGCTTCTCCCCGGGGTCCCGGG - Exonic
1010107109 6:72182778-72182800 CTGCTTGGCGCCCGGCGCCCTGG - Exonic
1010428081 6:75748806-75748828 GGGCTCCGCGCGGGGGACCCAGG - Intergenic
1011734240 6:90296336-90296358 CGGCTGCGCGCCCGGCGGCCGGG + Intronic
1012465852 6:99515510-99515532 AGGCGGCGCGCCCGGGGCCCGGG + Intronic
1013667396 6:112362537-112362559 CGGCTTGGGGTCTGGGGCCCTGG - Intergenic
1019340176 7:505220-505242 CGGCTTGGGGCCTGGGGGCCGGG - Intronic
1019750998 7:2729671-2729693 CGGCCTCGGGACGAGGGCCCTGG + Exonic
1020094691 7:5361828-5361850 CTGCTGCGCGCCTGGGGGCCTGG + Intronic
1022100303 7:27165352-27165374 CCGCTATGCGCCGGGGACCCTGG - Exonic
1024578420 7:50782771-50782793 CGGCTCCGCGGAGGGGCCCCCGG - Intronic
1024579853 7:50793038-50793060 CGCCTCCGGGCCGGGGGCTCCGG - Intronic
1025959272 7:66205736-66205758 CGGCTTCGCCCCGGCCGCCGGGG + Intronic
1027025886 7:74851410-74851432 CGGCTGCTCCCCGGTGGCCCAGG - Exonic
1027061873 7:75092700-75092722 CGGCTGCTCCCCGGTGGCCCAGG + Exonic
1027774086 7:82443586-82443608 CGGCTCCGCGCCTCGGGCCCCGG - Exonic
1029461047 7:100694070-100694092 GGGCTGCGGGCCGGGGGCCGCGG + Intergenic
1029640224 7:101815791-101815813 CGGCCTCGCGCGCGCGGCCCCGG - Intergenic
1031899447 7:127392873-127392895 GGCCCTCGCGCCGGCGGCCCCGG - Intronic
1032174435 7:129611968-129611990 CCGCCTCGGGCGGGGGGCCCCGG + Intronic
1033477213 7:141702262-141702284 CGCCTCCGCGGCGGGGCCCCGGG - Intergenic
1033660451 7:143398745-143398767 GCACTTCTCGCCGGGGGCCCGGG - Exonic
1036177334 8:6551108-6551130 CAGCTTCGAGTCAGGGGCCCAGG - Intronic
1037529111 8:19756993-19757015 CCGCTGCCCGCCGGGGGCCCAGG - Intronic
1038613142 8:29071815-29071837 CGGCTGCTCCCCGGGGGCCGAGG - Exonic
1038632941 8:29262941-29262963 CGCCTCCGCCCCGGCGGCCCAGG + Intronic
1049396471 8:142403270-142403292 CGGCTCCGCGCCGGGGCCTCTGG - Intergenic
1051774602 9:20621027-20621049 CGGCTTGGCCCCAGGCGCCCCGG + Intronic
1057488635 9:95506109-95506131 ACTCTGCGCGCCGGGGGCCCCGG - Intronic
1059123260 9:111661496-111661518 CGGCTCCGCGCCGGGTGGGCTGG + Exonic
1062446692 9:136598230-136598252 CGCCATTGCGCTGGGGGCCCAGG + Intergenic
1062686007 9:137813827-137813849 TGGCTTCGTGCTGGGGGCACAGG + Intronic
1185610784 X:1392664-1392686 AGGCTTCGCGCGGGGCCCCCCGG - Exonic
1186786028 X:12956443-12956465 CGGCTTCTGGCCTGGTGCCCCGG - Intergenic
1197712055 X:129678492-129678514 CGCCTACGCACCGGGGGCACTGG + Intergenic
1197774368 X:130110220-130110242 CGGCGTGGGGCTGGGGGCCCAGG - Intronic
1200233657 X:154458303-154458325 CGGCTGCGCGCTTGGGGCCCGGG + Exonic