ID: 1160897171

View in Genome Browser
Species Human (GRCh38)
Location 19:1408234-1408256
Sequence GCCCCGAACGGGAACTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 46}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160897159_1160897171 2 Left 1160897159 19:1408209-1408231 CCGCCGCCGCTTCCTGGTTGTGG 0: 1
1: 0
2: 0
3: 10
4: 155
Right 1160897171 19:1408234-1408256 GCCCCGAACGGGAACTTGGGGGG 0: 1
1: 0
2: 0
3: 3
4: 46
1160897157_1160897171 4 Left 1160897157 19:1408207-1408229 CCCCGCCGCCGCTTCCTGGTTGT 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1160897171 19:1408234-1408256 GCCCCGAACGGGAACTTGGGGGG 0: 1
1: 0
2: 0
3: 3
4: 46
1160897156_1160897171 5 Left 1160897156 19:1408206-1408228 CCCCCGCCGCCGCTTCCTGGTTG 0: 1
1: 0
2: 1
3: 24
4: 307
Right 1160897171 19:1408234-1408256 GCCCCGAACGGGAACTTGGGGGG 0: 1
1: 0
2: 0
3: 3
4: 46
1160897154_1160897171 22 Left 1160897154 19:1408189-1408211 CCAGAGGGGTTCAGGGGCCCCCG 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1160897171 19:1408234-1408256 GCCCCGAACGGGAACTTGGGGGG 0: 1
1: 0
2: 0
3: 3
4: 46
1160897164_1160897171 -10 Left 1160897164 19:1408221-1408243 CCTGGTTGTGGCGGCCCCGAACG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1160897171 19:1408234-1408256 GCCCCGAACGGGAACTTGGGGGG 0: 1
1: 0
2: 0
3: 3
4: 46
1160897158_1160897171 3 Left 1160897158 19:1408208-1408230 CCCGCCGCCGCTTCCTGGTTGTG 0: 1
1: 0
2: 0
3: 11
4: 239
Right 1160897171 19:1408234-1408256 GCCCCGAACGGGAACTTGGGGGG 0: 1
1: 0
2: 0
3: 3
4: 46
1160897161_1160897171 -1 Left 1160897161 19:1408212-1408234 CCGCCGCTTCCTGGTTGTGGCGG 0: 1
1: 0
2: 0
3: 5
4: 139
Right 1160897171 19:1408234-1408256 GCCCCGAACGGGAACTTGGGGGG 0: 1
1: 0
2: 0
3: 3
4: 46
1160897163_1160897171 -4 Left 1160897163 19:1408215-1408237 CCGCTTCCTGGTTGTGGCGGCCC 0: 1
1: 0
2: 0
3: 19
4: 180
Right 1160897171 19:1408234-1408256 GCCCCGAACGGGAACTTGGGGGG 0: 1
1: 0
2: 0
3: 3
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160897171 Original CRISPR GCCCCGAACGGGAACTTGGG GGG Intronic
910968651 1:92832285-92832307 GCCCGGTGCGCGAACTTGGGGGG + Intronic
917304747 1:173613674-173613696 GCCCCGTCCGGGAGGTTGGGGGG + Intronic
1072102113 10:92239422-92239444 GCCGCGCGAGGGAACTTGGGCGG + Exonic
1078371568 11:10751001-10751023 GCCCCGAATGAAAACTTGGAAGG - Exonic
1078646120 11:13142590-13142612 TCCCAGAACCGGAATTTGGGTGG - Intergenic
1082809637 11:57471622-57471644 GCCCCAAAGGGGAGCTTTGGAGG + Intronic
1085982836 11:81744882-81744904 GCCGTGGACGGGAACTGGGGCGG - Intergenic
1090805304 11:130198634-130198656 GCCCCCAACAGGAAGATGGGTGG - Intronic
1134515125 16:14880812-14880834 TCCCAGAAGAGGAACTTGGGTGG - Intronic
1134702800 16:16279459-16279481 TCCCAGAAGAGGAACTTGGGTGG - Intronic
1134964743 16:18432656-18432678 TCCCAGAAGAGGAACTTGGGTGG + Intronic
1134969030 16:18515191-18515213 TCCCAGAAGAGGAACTTGGGTGG + Intronic
1143781922 17:9233562-9233584 GGCCCGGACTGGAACTGGGGAGG + Intronic
1144339771 17:14301771-14301793 GCCCGGAACGGCAGCCTGGGGGG - Exonic
1147184948 17:38707970-38707992 GCACTGAAAGGGAACTTGGGAGG + Intronic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1160523961 18:79524718-79524740 GCCCCCGACGGGAACCTGGGTGG + Intronic
1160742839 19:695297-695319 CCCCCGTACGGGGACTTGGCGGG + Intronic
1160770348 19:828274-828296 GCCAGGAACGGGAACTGGCGGGG - Exonic
1160897124 19:1408103-1408125 ACCCCGAACGGCAACCTGGGGGG + Intronic
1160897171 19:1408234-1408256 GCCCCGAACGGGAACTTGGGGGG + Intronic
1162477302 19:10908235-10908257 AGCCAGGACGGGAACTTGGGTGG - Intronic
1163986082 19:20952643-20952665 GCCCCGTCCAGGAAGTTGGGTGG - Intergenic
1165243456 19:34484222-34484244 GCCCTGAACTGGATCTTGAGGGG + Intronic
1168213491 19:54908618-54908640 GCCCCGTCCGGGAGGTTGGGGGG - Intronic
928541974 2:32293724-32293746 GCCCCGTCCGGGAGGTTGGGGGG - Intronic
931304828 2:61017887-61017909 GGCCCGAGCGGGGACTTGGCAGG + Intronic
932374299 2:71221947-71221969 GCCCAGAAACGGAACATGGGAGG + Intronic
947398931 2:229713938-229713960 GCCCCGCCCGGGAACCAGGGCGG + Intronic
1181657901 22:24317443-24317465 GCCCCGTCCGGGAGGTTGGGGGG - Intronic
1183331596 22:37225089-37225111 GCCCTGAACTTGAACTTGGAAGG + Intergenic
1183331601 22:37225117-37225139 ACCCTGAACTTGAACTTGGGAGG + Intergenic
1184996889 22:48213819-48213841 GCCCTGAATGGGGACTTGTGAGG + Intergenic
962206677 3:133440624-133440646 GCCCAGAATCAGAACTTGGGGGG + Intronic
967880286 3:194297026-194297048 GCCCCGCACGGGGACTGAGGAGG + Intergenic
971556135 4:28014518-28014540 GCCCCCAATGGAAACATGGGTGG - Intergenic
984959311 4:185079203-185079225 GACCCAAATGTGAACTTGGGAGG - Intergenic
989654815 5:43734888-43734910 GCCCCCAATAGGATCTTGGGTGG + Intergenic
997869800 5:137497717-137497739 GCCCTGAAAGGGACCCTGGGTGG - Intronic
1004525135 6:16400350-16400372 GCCCTGAACAGGGGCTTGGGAGG - Intronic
1005661198 6:28001162-28001184 GGCCCTAAAGGGAACGTGGGAGG + Intergenic
1006523214 6:34583977-34583999 GCCCCAGACTGGATCTTGGGAGG + Intergenic
1009622619 6:66096734-66096756 GCCCCGTCCGGGAGGTTGGGGGG - Intergenic
1022992854 7:35725560-35725582 GCCCTGCACGGGAAGTGGGGAGG + Intergenic
1025943282 7:66088803-66088825 GCCCAGAACAGGAACTCGGCTGG - Exonic
1034255431 7:149722302-149722324 ACCTCGAACAGGGACTTGGGTGG + Intronic
1034528061 7:151678560-151678582 GCCCCGGGCTGGCACTTGGGAGG + Intronic
1037838510 8:22228448-22228470 GCCTCGAAAGGGATATTGGGAGG - Intronic
1189365015 X:40381266-40381288 GCCTCGAAGGGGAACTGGTGAGG - Intergenic
1193021332 X:76796897-76796919 GGCCCCAATGGGAACATGGGAGG + Intergenic