ID: 1160897479

View in Genome Browser
Species Human (GRCh38)
Location 19:1409401-1409423
Sequence CATGGACACCCTTGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160897465_1160897479 28 Left 1160897465 19:1409350-1409372 CCGTGGCTGTGAGGAGGCTGGAG 0: 1
1: 1
2: 4
3: 45
4: 508
Right 1160897479 19:1409401-1409423 CATGGACACCCTTGGGAAGTGGG 0: 1
1: 0
2: 0
3: 16
4: 207
1160897470_1160897479 -8 Left 1160897470 19:1409386-1409408 CCTGTCCCCTCCCTGCATGGACA No data
Right 1160897479 19:1409401-1409423 CATGGACACCCTTGGGAAGTGGG 0: 1
1: 0
2: 0
3: 16
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160897479 Original CRISPR CATGGACACCCTTGGGAAGT GGG Intronic
900436675 1:2634337-2634359 CAGGGCCAGCCTTGGGGAGTCGG - Intergenic
902131649 1:14266758-14266780 CATGCACATCTTTGGGATGTGGG + Intergenic
902219659 1:14957007-14957029 CTCGGACACCCTTGAGAAGTTGG - Intronic
902436229 1:16399560-16399582 CATGCCCAGCCTTGGGAAGCAGG + Intronic
902654537 1:17858484-17858506 AATGGAGACCAGTGGGAAGTTGG + Intergenic
904693591 1:32313772-32313794 CATGCACATCTTTGGGATGTGGG - Intronic
905389379 1:37626440-37626462 CATGGACAGCCCCGGGGAGTTGG - Intronic
905764327 1:40587494-40587516 CCTGGACAGCCTTGGGATGGGGG - Intergenic
905914419 1:41675047-41675069 CAGGGACACCCATGGGAGGATGG - Intronic
906294956 1:44644019-44644041 CATGGACTGCTTTGAGAAGTAGG + Intronic
907274977 1:53311893-53311915 CATGGTGGCCCTTGGGAGGTGGG - Intronic
909463931 1:75951326-75951348 CATGCACAGCTTTGGGATGTGGG + Intergenic
909878982 1:80848536-80848558 CAAGGACACCCATGGGACCTGGG - Intergenic
913708267 1:121450367-121450389 CATGCACATCTTTGGGACGTGGG + Intergenic
915368838 1:155331035-155331057 CCTGGACACCCTTGGTGGGTGGG + Exonic
915692992 1:157709183-157709205 CAAGAACACCCTTGAGAAGAAGG + Intergenic
918257930 1:182766927-182766949 CATGTGCAGCCTTGGGAAGCTGG + Intergenic
919701817 1:200638879-200638901 CGTGCACACCTTTGGGATGTGGG - Intronic
919815579 1:201436496-201436518 CAAGGACACACATGGGAAGGAGG + Intergenic
920400449 1:205672941-205672963 CATGTTCACCCTTGTGAAATAGG + Intronic
921289323 1:213641703-213641725 AATGGACACCCTAGAGAACTGGG - Intergenic
1062789146 10:290482-290504 CATGCACATACTTGGGATGTCGG + Intronic
1062869707 10:889433-889455 CATGCACACCTTTGGGATGTGGG + Intronic
1062912081 10:1217823-1217845 CATGGCGACCCTTGGTAATTAGG - Intronic
1063031898 10:2243974-2243996 CATGGAGACCCTGAGGAAGGAGG + Intergenic
1063615584 10:7597241-7597263 CATGGACACCAGTGGGGAGGGGG + Intronic
1067470951 10:46537246-46537268 CAGGGATACCCTTGGGAGTTTGG + Intergenic
1068433078 10:56957942-56957964 CATGCACATCTGTGGGAAGTGGG - Intergenic
1068894339 10:62182813-62182835 CATGCACATCTTTGGGATGTGGG + Intergenic
1069510220 10:69036544-69036566 CATGGACATCTTTGGGGAGGTGG + Intergenic
1069927706 10:71862553-71862575 CAGGGACATCCTAGGCAAGTCGG - Intergenic
1072606901 10:96991871-96991893 CAGGGCCACACTGGGGAAGTGGG - Intergenic
1073369455 10:102974053-102974075 CATTGACGTCCTTGGGAACTAGG + Intronic
1076019734 10:127062776-127062798 CATGGACACCCTGAGAAATTAGG - Intronic
1076947907 10:133664744-133664766 CACGGACTCCCCTGGGACGTGGG - Intergenic
1076948897 10:133668054-133668076 CACGGACTCCCCTGGGACGTGGG - Exonic
1076949881 10:133671353-133671375 CACGGACTCCCCTGGGACGTGGG - Intronic
1076950865 10:133674652-133674674 CACGGACTCCCCTGGGACGTGGG - Intergenic
1076951855 10:133677962-133677984 CACGGACTCCCCTGGGACGTGGG - Intergenic
1076952844 10:133681272-133681294 CACGGACTCCCCTGGGACGTGGG - Intergenic
1076953828 10:133684571-133684593 CACGGACTCCCCTGGGACGTGGG - Intergenic
1076954812 10:133740923-133740945 CACGGACTCCCCTGGGACGTGGG - Intergenic
1076955801 10:133744233-133744255 CACGGACTCCCCTGGGACGTGGG - Intergenic
1076956791 10:133747543-133747565 CACGGACTCCCCTGGGACGTGGG - Intergenic
1076957778 10:133750852-133750874 CACGGACTCCCCTGGGACGTGGG - Intergenic
1076958763 10:133754151-133754173 CACGGACTCCCCTGGGACGTGGG - Intergenic
1076959752 10:133757461-133757483 CACGGACTCCCCTGGGACGTGGG - Intergenic
1076960736 10:133760760-133760782 CACGGACTCCCCTGGGACGTGGG - Intergenic
1077413858 11:2415481-2415503 CATGGGCACCCGAGGGAAGGGGG + Intronic
1078453407 11:11456936-11456958 CATGGAGACAAGTGGGAAGTGGG + Intronic
1078670823 11:13363767-13363789 CAGGGTCACTCTTGGGAAGATGG - Intronic
1079341606 11:19616421-19616443 TATGGACACCCTTGGGAGAAAGG - Intronic
1082794907 11:57371689-57371711 CAGGGTCAGCCTTGGGAATTGGG + Intergenic
1083009243 11:59379782-59379804 CATATAGACCATTGGGAAGTAGG - Intergenic
1084653326 11:70501545-70501567 CAGGGACACCTTTGGAAAGAGGG - Intronic
1084941544 11:72615885-72615907 CTTGCACACCCTTGGGGACTAGG - Intronic
1087021898 11:93611361-93611383 CATGGACATCTTTGGGGAGGGGG + Intergenic
1087432534 11:98071671-98071693 CATGTACATCTTTGGGATGTTGG - Intergenic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1089046204 11:115503858-115503880 AATGGACAGCCCTGGGAGGTGGG + Intronic
1090575613 11:128099592-128099614 CATGGTCATCTATGGGAAGTGGG + Intergenic
1090803172 11:130187342-130187364 CATGGATACCCTTGGCAGGGAGG + Intronic
1093255809 12:16866734-16866756 CATGGCCAGCCTTTGGAAATGGG + Intergenic
1094826727 12:34275291-34275313 CAGGGACACCCTTGGGAGGGTGG + Intergenic
1096469231 12:51865778-51865800 CATCTACACCCTGGGGGAGTAGG - Intergenic
1096653784 12:53075785-53075807 CATGGAAACTCTGGTGAAGTTGG - Exonic
1099635598 12:85206923-85206945 CATGGAGACCCTTGGAAGATGGG + Intronic
1100020999 12:90069516-90069538 CTTGGCCACATTTGGGAAGTAGG + Intergenic
1101379858 12:104205162-104205184 CATGGACACCAAGGGGAATTCGG - Intergenic
1101614248 12:106320518-106320540 CATGCACATCTTTGGGATGTGGG - Intronic
1103770339 12:123317755-123317777 CATGGACACATTTGGGTAGGTGG - Intronic
1106221698 13:27751333-27751355 CCTGCTCACCCTTGGGAAGTGGG + Intergenic
1107059727 13:36146331-36146353 CTTGGACATCCTTGAGAAATAGG - Intergenic
1108402440 13:50060496-50060518 CATGCACATCTTTGGGATGTGGG - Intergenic
1109941761 13:69376910-69376932 CATGGGAACCCTTGTGAAGGGGG + Intergenic
1110280138 13:73683421-73683443 CAAGGCCACCCTTGAGATGTTGG + Intergenic
1113143029 13:107175725-107175747 CAATGACACCCTTGGGACCTGGG + Intronic
1113745637 13:112742260-112742282 CATGGGAACCCTTGGGGGGTGGG + Intronic
1115630871 14:35243793-35243815 CATAGACACCCTTATGAATTTGG - Intronic
1116500047 14:45609656-45609678 CTTGCACACCCTTGGGGATTTGG + Intergenic
1118451135 14:65903498-65903520 CATGGACATCTTTGAGGAGTGGG - Intergenic
1119752533 14:77090004-77090026 TATGGACCCCATTGGGCAGTGGG - Intergenic
1121252090 14:92506804-92506826 CAACGAGACCCTTGGGCAGTGGG + Intergenic
1121373434 14:93382359-93382381 CCTGGACATCTTTGGGGAGTGGG - Intronic
1122826440 14:104373065-104373087 CCAGGACTCCCTTGGGAAGGAGG - Intergenic
1202860597 14_GL000225v1_random:79135-79157 CATGGACTCCCCTGGGACGCGGG + Intergenic
1129832498 15:78679820-78679842 AGGGGACACCCTGGGGAAGTGGG + Intronic
1129962270 15:79697993-79698015 CATGGACATCCTTGGCATGAGGG - Intergenic
1131002088 15:88947080-88947102 CATGACCTCCCTTGGGAAGAGGG + Intergenic
1136048547 16:27634471-27634493 CTAGGACACCATTGGGAAGGTGG + Intronic
1138558107 16:57784694-57784716 CTTGGAGACCTTGGGGAAGTGGG + Intronic
1139421768 16:66853531-66853553 CATGGAAGCCCTTGAGAAGATGG - Exonic
1141291314 16:82720565-82720587 CATGCACAACTTTGGGATGTGGG + Intronic
1141813162 16:86390122-86390144 CTTGCACAACCTTGAGAAGTAGG + Intergenic
1142218596 16:88841855-88841877 CAGGGACACCCTTGGGGTGCAGG - Intronic
1147611231 17:41803019-41803041 CCTGGACACCCATTGGGAGTGGG - Intronic
1148020059 17:44547721-44547743 AATGGATACCCCTGGGAAGGAGG - Intergenic
1150774169 17:68065852-68065874 GACACACACCCTTGGGAAGTTGG + Intergenic
1151788398 17:76287940-76287962 CAAGGGCACACTTGGGAAGCGGG - Intronic
1160897479 19:1409401-1409423 CATGGACACCCTTGGGAAGTGGG + Intronic
1162004141 19:7766484-7766506 CAGGGAGAGTCTTGGGAAGTAGG + Intronic
1163362292 19:16854624-16854646 CATGCACATCTTTGGGATGTGGG - Intronic
1164852110 19:31492574-31492596 CTTGGGCACCCTTGGGCAATGGG + Intergenic
1167611869 19:50511636-50511658 AAGGGAGACCCTGGGGAAGTGGG + Exonic
1168591871 19:57643029-57643051 AAAGGACACCCTGAGGAAGTGGG + Intergenic
925450851 2:3968279-3968301 CAAGGGCACCCTTGAGAAGAGGG + Intergenic
927854244 2:26517947-26517969 TATGGACACCCATGGGAAGGCGG - Intronic
928896823 2:36275405-36275427 CATGCACATCTTTGGGATGTAGG - Intergenic
929597550 2:43185889-43185911 CAAGGACGCCCTTGGTGAGTGGG + Intergenic
930034716 2:47078308-47078330 AATCGACAACCTTGGGAGGTGGG + Intronic
931591515 2:63888674-63888696 CATGCACATCTTTGGGATGTGGG + Intronic
932497166 2:72151531-72151553 CATGGACAGGCTTGTGAAGAGGG + Intergenic
932558913 2:72850269-72850291 CATGGTCACTCTAGGGAAGCTGG - Intergenic
935620959 2:105129075-105129097 CAAGAACAGCCTTGGTAAGTAGG + Intergenic
936040565 2:109146327-109146349 CCTGGCCACCTTTGGGAAGCTGG - Intronic
936535080 2:113305413-113305435 CACGGGCAGCCTTGGGAAGAAGG + Intergenic
937503891 2:122514512-122514534 CCAGGACACCCTAGGGAACTTGG - Intergenic
938210059 2:129459692-129459714 CACCAACATCCTTGGGAAGTGGG - Intergenic
940197105 2:151106909-151106931 CATAGACAGCTTTGTGAAGTAGG + Intergenic
941363256 2:164579580-164579602 CCTGCACATCTTTGGGAAGTGGG + Intronic
941513713 2:166445631-166445653 CATGGACACACATGTGAAGTGGG - Intronic
942439573 2:176018978-176019000 CATGGCCACACTTGGCAAGGAGG + Intergenic
946526628 2:220527661-220527683 CATGGACCCCCTGGTAAAGTGGG + Intergenic
946846169 2:223860722-223860744 CCTGGCCACCCTTGGAGAGTGGG + Intronic
1169618385 20:7476113-7476135 CATGCACAACCTTAGGAAGGTGG + Intergenic
1170487371 20:16832489-16832511 CATGGCCACCCTTGGCAAATAGG + Intergenic
1173906309 20:46632174-46632196 CCTGGACACTCCTGAGAAGTGGG - Intronic
1178020662 21:28404613-28404635 CATGGACACCTTTGGGAGGGAGG + Intergenic
1179310895 21:40195568-40195590 CCTGGACACCCTGGGACAGTTGG - Intronic
1180766682 22:18349437-18349459 CTTGGTCACCCTGGGGGAGTTGG + Intergenic
1180779632 22:18512941-18512963 CTTGGTCACCCTGGGGGAGTTGG - Intergenic
1180812347 22:18770262-18770284 CTTGGTCACCCTGGGGGAGTTGG - Intergenic
1180842775 22:18967003-18967025 CATTGACACGCTTGGGCAGCAGG + Intergenic
1181058675 22:20271732-20271754 CATTGACACACTTGGGCAGCAGG - Intronic
1182144441 22:27988665-27988687 AGTGGACACCCTTGAGAAGATGG - Intronic
1183639403 22:39083929-39083951 CAGGGACACCCATGGGCAGAAGG + Intronic
1183764077 22:39854120-39854142 CGTGCACATCCTTGGGAAGTGGG + Intronic
1184021344 22:41823789-41823811 CATGCACATCTTTGGGATGTGGG + Intronic
950479809 3:13237287-13237309 CAGGGACACCCTGTGGAAGGTGG + Intergenic
950895311 3:16444435-16444457 CATGCACATCTTTGGGATGTGGG - Intronic
955228115 3:57077788-57077810 CAAGGACACTGTTGGGAAATGGG - Intronic
956238940 3:67107378-67107400 CATGCACAGCCTTGGGATGTGGG - Intergenic
956679609 3:71765873-71765895 CATGGCCACACTTGGGCAGCTGG + Intergenic
957014286 3:75044564-75044586 GATGGACAGCCTTGGGGAATGGG + Intergenic
957943904 3:87038126-87038148 CAGGGACAGCCTTGTGAATTAGG - Intergenic
961401844 3:126652611-126652633 CATGGACATCTTTGGGATGTGGG - Intronic
962162903 3:133018319-133018341 GATGGACAGCTTTGGGAAGTGGG + Intergenic
963446571 3:145417358-145417380 CATGCACATCTTTGGGATGTGGG + Intergenic
965188590 3:165499604-165499626 CATGGACATCTTTGGAAAGAAGG - Intergenic
966612796 3:181884604-181884626 CATGCACATCTTTGGGATGTGGG + Intergenic
970133142 4:12893171-12893193 CATGCACTCCATTGGGCAGTGGG + Intergenic
972931960 4:44082928-44082950 CATGCACATCTTTGGGATGTGGG - Intergenic
975652517 4:76608176-76608198 CATACACAACCTTGGGAAGAAGG + Intronic
975707708 4:77127545-77127567 CTTGGTCACCCTTGGGGAGGAGG - Intergenic
980532267 4:134070950-134070972 CATGGCGAGCCTTGGGAAATGGG + Intergenic
985446023 4:190021740-190021762 CACGGACTCCCCTGGGACGTGGG + Intergenic
985451361 4:190065545-190065567 CACGGACTCCCCTGGGACGTGGG - Intergenic
985452351 4:190068838-190068860 CACGGACTCCCCTGGGACGTGGG - Intergenic
985453336 4:190072135-190072157 CACGGACTCCCCTGGGACGTGGG - Exonic
985454326 4:190075428-190075450 CACGGACTCCCCTGGGACGTGGG - Exonic
985455314 4:190078721-190078743 CACGGACTCCCCTGGGACGTGGG - Exonic
985456302 4:190082021-190082043 CACGGACTCCCCTGGGACGTGGG - Exonic
985457286 4:190085315-190085337 CACGGACTCCCCTGGGACGTGGG - Intergenic
985458273 4:190088608-190088630 CACGGACTCCCCTGGGACGTGGG - Exonic
985459262 4:190091908-190091930 CACGGACTCCCCTGGGACGTGGG - Exonic
985463514 4:190174677-190174699 CACGGACTCCCCTGGGACGTGGG - Exonic
985801108 5:2005722-2005744 CAGGGACACTCTTGGGGAGCTGG + Intergenic
988643583 5:33068909-33068931 GAAGGACAGCCTTGGGAAATGGG + Intergenic
989969839 5:50510312-50510334 CATGCACATCTTTGGGACGTGGG - Intergenic
990107907 5:52287267-52287289 CATGTACATCTTTGGGATGTGGG + Intergenic
990220452 5:53582482-53582504 CATGTACATCCTTCGGATGTGGG + Intronic
992666842 5:79018552-79018574 CATGGACACCCCGGGGATGAGGG + Intronic
994019477 5:95006027-95006049 CATGCACATCTTTGGGATGTGGG + Intronic
996778791 5:127160772-127160794 CATGCATACCCTTAGGAAGGGGG - Intergenic
999827565 5:155288732-155288754 AATGGACACCCTTGGGAATGTGG + Intergenic
1003875516 6:10432878-10432900 CTTGGAAACCCATGAGAAGTTGG + Intergenic
1004870606 6:19900404-19900426 CATGCACAGCTTTGGGATGTGGG + Intergenic
1006184762 6:32175582-32175604 AATGGAAACCCTTGTGAATTTGG - Intronic
1006516945 6:34550467-34550489 CTTGGAGACCCTGGGGAAGCAGG - Intronic
1006589006 6:35140932-35140954 CAGGGACCCCCTTGGCAATTGGG - Intronic
1009425296 6:63507042-63507064 CATGGGGACCCTGGGGAAGGTGG - Intergenic
1010879407 6:81149795-81149817 CACGGACACTGTAGGGAAGTGGG - Intergenic
1012111018 6:95233968-95233990 CATGCACAGCTTTGGGATGTGGG - Intergenic
1014237130 6:118970594-118970616 CATATACATCCTTGGGAATTGGG - Intronic
1014485921 6:121999077-121999099 CATTGGAACCCCTGGGAAGTGGG + Intergenic
1015987424 6:138898417-138898439 CTTGGACAGCGTTAGGAAGTAGG - Intronic
1016075404 6:139789200-139789222 CATGGTGAGCCTTGGGAGGTAGG + Intergenic
1016284508 6:142457944-142457966 CAGGCACACCTTTGGGATGTGGG - Intergenic
1019175740 6:170158522-170158544 CATGGGCAGCCTTGAGAAGCTGG + Intergenic
1019578276 7:1748101-1748123 CGTGGGAACCCTTGGGAGGTGGG + Intergenic
1020017113 7:4837494-4837516 CAGAGACAGCCTTGGGAAGGAGG - Intronic
1020059793 7:5143762-5143784 CATGGACACCCAGGGGAGGGAGG - Intergenic
1020168176 7:5823989-5824011 CATGGACACCCAGGGGAGGGAGG + Intergenic
1021232621 7:18104053-18104075 CATGCACAGCTTTGGGATGTGGG + Intronic
1021565740 7:22014630-22014652 CTTGGACACTCATGGAAAGTGGG + Intergenic
1024626064 7:51209360-51209382 ACTAGACACCCCTGGGAAGTGGG + Intronic
1028695629 7:93707927-93707949 CATGGACAACTTTTTGAAGTGGG - Intronic
1028731025 7:94148634-94148656 CATGGACTACCATGGGAAGGAGG - Intergenic
1030164592 7:106541026-106541048 CATGTACATCTTTGGGACGTGGG + Intergenic
1031442326 7:121809892-121809914 CATGGTCACCTTTGGTAATTGGG - Intergenic
1032623398 7:133561731-133561753 CATGCACAGCTTTGGGATGTGGG - Intronic
1033250488 7:139754122-139754144 AAGAGACACCCTTTGGAAGTGGG + Intronic
1035868777 8:3113656-3113678 CATTGACATCCCTGAGAAGTGGG + Intronic
1035902647 8:3474171-3474193 CATGCACAGCTTTGGGATGTGGG - Intronic
1037281005 8:17242097-17242119 CGTGCACAGCCTTGGGATGTGGG + Intronic
1041356479 8:57005930-57005952 TATGGAGAGCCTTGGGGAGTGGG + Intergenic
1042373688 8:68022429-68022451 AAAGGACACCCTAGGGAACTGGG - Intronic
1043561672 8:81500691-81500713 CATGGACCTGCTTGGGAGGTAGG + Intergenic
1047786756 8:128160868-128160890 CATGGATACCTTTGTGCAGTAGG - Intergenic
1049130491 8:140835869-140835891 CATGCACATCTTTGGGATGTGGG - Intronic
1050779409 9:9312549-9312571 CATGCACATCTTTGGGATGTAGG - Intronic
1056278401 9:85015759-85015781 AAAGGAGACCTTTGGGAAGTAGG + Intronic
1056897132 9:90561529-90561551 CATGGACACCCTGTAGAAGCAGG + Intergenic
1060145923 9:121252314-121252336 CAAGGACACGCTTGGGGAGTTGG + Intronic
1187387039 X:18858314-18858336 GATGGATACCCTTGGGGAGGTGG - Intergenic
1188931986 X:36123385-36123407 CCTGGACACACTTGGGACCTGGG - Intronic
1191674635 X:63782024-63782046 CATAGAGACACATGGGAAGTTGG - Intronic
1193148507 X:78101963-78101985 AATGGATGCCCCTGGGAAGTCGG + Intronic
1194754894 X:97727389-97727411 CATGGACATCTTTGGGAAGGGGG - Intergenic
1196365693 X:114921282-114921304 CATGCACAGCTTTGGGATGTGGG - Intergenic
1197201445 X:123752226-123752248 TATGGGCACCCTTGAGAAGCTGG + Intergenic
1198641623 X:138762251-138762273 CAAAGGCACCATTGGGAAGTTGG - Intronic
1198719878 X:139605132-139605154 CATGGATAACTTTGGGAAGTAGG - Intronic
1201177079 Y:11315824-11315846 CACGGACTCCCCTGGGATGTGGG - Intergenic