ID: 1160899919

View in Genome Browser
Species Human (GRCh38)
Location 19:1422489-1422511
Sequence TGTAGCAAACAGCCTCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 262}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160899915_1160899919 2 Left 1160899915 19:1422464-1422486 CCGCCAGGCACACACAGGTGGCG 0: 1
1: 0
2: 0
3: 20
4: 180
Right 1160899919 19:1422489-1422511 TGTAGCAAACAGCCTCAGGAAGG 0: 1
1: 0
2: 0
3: 26
4: 262
1160899908_1160899919 29 Left 1160899908 19:1422437-1422459 CCTCCCTCAGATGGCAAACTATC 0: 1
1: 0
2: 0
3: 0
4: 80
Right 1160899919 19:1422489-1422511 TGTAGCAAACAGCCTCAGGAAGG 0: 1
1: 0
2: 0
3: 26
4: 262
1160899914_1160899919 3 Left 1160899914 19:1422463-1422485 CCCGCCAGGCACACACAGGTGGC 0: 1
1: 0
2: 3
3: 33
4: 256
Right 1160899919 19:1422489-1422511 TGTAGCAAACAGCCTCAGGAAGG 0: 1
1: 0
2: 0
3: 26
4: 262
1160899910_1160899919 25 Left 1160899910 19:1422441-1422463 CCTCAGATGGCAAACTATCTCAC 0: 1
1: 0
2: 1
3: 9
4: 95
Right 1160899919 19:1422489-1422511 TGTAGCAAACAGCCTCAGGAAGG 0: 1
1: 0
2: 0
3: 26
4: 262
1160899917_1160899919 -1 Left 1160899917 19:1422467-1422489 CCAGGCACACACAGGTGGCGGCT 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1160899919 19:1422489-1422511 TGTAGCAAACAGCCTCAGGAAGG 0: 1
1: 0
2: 0
3: 26
4: 262
1160899909_1160899919 26 Left 1160899909 19:1422440-1422462 CCCTCAGATGGCAAACTATCTCA 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1160899919 19:1422489-1422511 TGTAGCAAACAGCCTCAGGAAGG 0: 1
1: 0
2: 0
3: 26
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160899919 Original CRISPR TGTAGCAAACAGCCTCAGGA AGG Intronic
901789361 1:11646355-11646377 TGCAGCCAAGAGCCTGAGGAAGG - Intergenic
902331905 1:15734982-15735004 TGCAGCAAACAGGAACAGGACGG - Intergenic
904200545 1:28816590-28816612 TTTAGCAAACAGCCTGTGGCTGG + Intronic
904949499 1:34224968-34224990 TAGAGCAACCAGCCTCAAGAAGG + Intergenic
908810085 1:67972871-67972893 TCTAGAAAATAGCCTCAGAAGGG - Intergenic
909139590 1:71846643-71846665 TGTAACAAAAAGCCTTAGAATGG + Intronic
909752347 1:79178451-79178473 TGTTGCAAACAGACACAGGGAGG + Intergenic
910205488 1:84745002-84745024 GGTAGCAAATAGCCTACGGAGGG - Intergenic
910349124 1:86276166-86276188 TTTAGAAAATAGCCTCAGAAGGG - Intergenic
910379101 1:86607442-86607464 TATAAGAAACAGCCTCAAGAGGG - Intergenic
910627303 1:89321662-89321684 TCTAGAAAACAGCCTCAAAAAGG - Intergenic
910760631 1:90727904-90727926 TGTAGAAAAAAGCTGCAGGAGGG - Intergenic
911052693 1:93684595-93684617 GGGAGGAAACAGACTCAGGAAGG + Intronic
911281042 1:95929370-95929392 TCTAGAAAACAGCTACAGGAAGG - Intergenic
911343772 1:96672655-96672677 TCTAGAAAATAGCCTCAGAAAGG - Intergenic
911938946 1:104017995-104018017 TCTAGCAAATACCCTCAAGAGGG - Intergenic
912601290 1:110935697-110935719 TCTAGAAAATAGCCTCAGAAGGG + Intergenic
912871749 1:113312957-113312979 TCTAGAAAACAGCCTCAAAAAGG + Intergenic
912899092 1:113629057-113629079 TCTAGAAAACAGCCTCAAAAGGG - Intronic
913032383 1:114922272-114922294 TCTAGAAAACAGCCTCAAAAGGG - Intronic
913503145 1:119490202-119490224 TGTGGTAAACAGCCACAGAATGG - Intergenic
914937894 1:151996215-151996237 TTTAAAAAACAGCCTCAGGCAGG + Intergenic
915659824 1:157394055-157394077 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
915852444 1:159340004-159340026 TGTAGCATAGAGGGTCAGGAAGG + Intergenic
917986447 1:180325237-180325259 TCTAGAAAACAGCCTCAAAAGGG - Intronic
919037929 1:192340389-192340411 AGTAGCAAAGAGACTCAGAAAGG + Intronic
919511690 1:198473158-198473180 TGTAGAAAATAGCCTCAAAAGGG + Intergenic
920872385 1:209805464-209805486 TGTGCCAAACAGACTCAGGGAGG + Intronic
922793156 1:228321727-228321749 TGTAGCAGCCAGCATCAGCACGG - Exonic
923334005 1:232951139-232951161 TGTAGCAAAGACCCACAGTAAGG - Intronic
923792153 1:237120903-237120925 TGCAACCCACAGCCTCAGGAGGG - Intronic
1063302929 10:4868297-4868319 TGGAGCAAAGAGACTCAGGATGG - Intergenic
1063887235 10:10592202-10592224 TGTTCCCAAGAGCCTCAGGATGG + Intergenic
1064648301 10:17482571-17482593 CCTAGCACACAGCTTCAGGAGGG + Intergenic
1064697417 10:17982159-17982181 TGTAGCTGTCAGCCCCAGGAAGG + Intronic
1066142811 10:32525012-32525034 TCTAGAAAACAGCCTCATGAGGG - Intronic
1067438823 10:46296850-46296872 TGTAACAGACAGGCTCAGGGAGG - Intronic
1068329960 10:55550462-55550484 TATAGAATACAGCCTCAGTAAGG + Intronic
1069193298 10:65518142-65518164 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
1072282678 10:93882706-93882728 TCTAGAAAACAGCCTCAAAAGGG + Intergenic
1073268850 10:102244821-102244843 TATAGGAAACAGCCCCAGGGTGG - Intergenic
1073604854 10:104883913-104883935 TGTGGCAAACAGCTTCAGTGAGG + Intronic
1073965287 10:108981878-108981900 TGTAGCACTCAGTCTCAGGCTGG + Intergenic
1074457898 10:113611542-113611564 TGAAGCAGACAGGCCCAGGAGGG - Intronic
1074788066 10:116859211-116859233 TGTAGCCAAGAGACTCAGAAAGG - Intronic
1075194781 10:120346882-120346904 TATAGCAAACATCCTAAGAAAGG - Intergenic
1076074773 10:127524434-127524456 TGTAGCAAAATGCCTGAGCATGG - Intergenic
1076296718 10:129391551-129391573 GGTGGCACACAGCCTCAGGATGG + Intergenic
1078244477 11:9561729-9561751 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
1079069087 11:17327566-17327588 TCTAGAAAACAGCCTCAAAACGG - Intronic
1079183707 11:18216791-18216813 TCTAGAAAACAGTCTCAGAAAGG + Intronic
1081582510 11:44362026-44362048 TGTAGCAATCAGCCCCAACAAGG - Intergenic
1081703137 11:45164381-45164403 TGCAGCCAACAGCCCCAGGAGGG - Intronic
1082791096 11:57347316-57347338 CATAACCAACAGCCTCAGGAGGG - Intronic
1086033264 11:82385236-82385258 TCTAGAAAACAGCCTCAAAAGGG + Intergenic
1088806473 11:113357967-113357989 TGTGGCAAACACCCGCAGGGAGG - Intronic
1089497912 11:118916979-118917001 CTGAGCAAACAGCCTCAGGGAGG + Intronic
1090024076 11:123152866-123152888 TGTCCCAAACATACTCAGGAGGG + Intronic
1090065088 11:123496590-123496612 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
1091336256 11:134768795-134768817 CCTAGAAAACAGCCTCAGAAAGG + Intergenic
1093912126 12:24760008-24760030 ATTTGCAAACACCCTCAGGATGG - Intergenic
1095227757 12:39696926-39696948 TCTAGAAAATAGCCTCAAGAGGG + Intronic
1096451148 12:51742841-51742863 TCTAGCAAATAGCCTCAAAAGGG - Intronic
1096761114 12:53842766-53842788 TGTTGCAAAGAGCAGCAGGAGGG - Intergenic
1097899040 12:64855469-64855491 TCTAGCAAATAGCCTCAAAAGGG - Intronic
1098188723 12:67925461-67925483 TATAGCAATCAGTGTCAGGAAGG - Intergenic
1098705757 12:73686482-73686504 TGTAGCAAATATCCTCAAAAGGG + Intergenic
1100460922 12:94798545-94798567 GGTAGAGCACAGCCTCAGGATGG - Intergenic
1100909008 12:99337144-99337166 TTTAGCAAATAGCCTCAAAAGGG - Intronic
1104417616 12:128608245-128608267 TGCAACAAACAGCCTCACAAGGG + Intronic
1105036136 12:132922926-132922948 TCTAGAAGACAGCCTCAGGGGGG + Exonic
1107174600 13:37385708-37385730 TCCATGAAACAGCCTCAGGAAGG - Intergenic
1107908180 13:45081469-45081491 TGTCGCACAGATCCTCAGGATGG + Intergenic
1108118648 13:47159964-47159986 TGGAGCACACAGCCCCAGCAGGG - Intergenic
1108138162 13:47387493-47387515 TTTAGAAAATAGCCTCAGAAGGG + Intergenic
1108251413 13:48571571-48571593 GACAGCAAACAGCCCCAGGAGGG + Intergenic
1108878969 13:55085845-55085867 TCTAGAAAACAGCTTCAAGAGGG - Intergenic
1109313642 13:60724472-60724494 TGGAAGAAACAGCCTCAGGAGGG + Intergenic
1109680163 13:65741171-65741193 TCAAGCAAACTGCTTCAGGAAGG + Intergenic
1109923884 13:69107765-69107787 TCAAGAAAACAGCCTCAGAAGGG + Intergenic
1110785834 13:79524587-79524609 CATAGCAAACAGATTCAGGATGG + Intronic
1110915030 13:81010800-81010822 TGTAGAAAATAGCCTCAAAAAGG - Intergenic
1113103569 13:106748117-106748139 TTGAGCAGACAGCCTGAGGAAGG - Intergenic
1113254072 13:108487424-108487446 TCTAGAAAACAGCCTCAAAAGGG + Intergenic
1118160406 14:63283706-63283728 TGTCACAAACAGCATCTGGAAGG + Intronic
1120588473 14:86346132-86346154 TGGAACATACAGACTCAGGATGG - Intergenic
1121063209 14:90936614-90936636 TCTAGAATACAGGCTCAGGAGGG + Intronic
1121455025 14:94032832-94032854 TGTGGGCATCAGCCTCAGGAAGG - Intronic
1122308342 14:100779455-100779477 GGTAACCACCAGCCTCAGGAAGG - Intergenic
1123796880 15:23781512-23781534 AGTAGCAAGCAGGGTCAGGAAGG - Intergenic
1125411564 15:39411497-39411519 TTTAGCCCAGAGCCTCAGGAAGG + Intergenic
1126532308 15:49724784-49724806 TGGAGCATAGAGACTCAGGATGG + Intergenic
1128332161 15:66763007-66763029 TGAAGGAAGCAGCCTCAGAAGGG - Intronic
1128457591 15:67840866-67840888 TTTAGCAAACAGGCTCTGGGAGG + Intergenic
1129076251 15:72998811-72998833 TGGTGCAAAACGCCTCAGGATGG + Intergenic
1130241732 15:82199732-82199754 TGTAGGAATCAGCCCTAGGAAGG + Intronic
1130511976 15:84596958-84596980 TCTAGAAAACAGCCTCAGAAGGG + Intergenic
1130549986 15:84884277-84884299 TGTGGCAAAAAGCCACAGGCTGG - Intergenic
1131899876 15:97076173-97076195 TGAAACAATCAGCCTCAGAAGGG + Intergenic
1131927224 15:97398995-97399017 TATTGCAAACAGCCAAAGGATGG - Intergenic
1131945077 15:97610547-97610569 TCTAGAAAAGAGCCTCAGAAGGG + Intergenic
1134034506 16:11019330-11019352 TGTAGCAATCAGCTTAAGCATGG - Intronic
1135683525 16:24479075-24479097 TGTAGCCAAGAGCTACAGGATGG - Intergenic
1137753061 16:50880732-50880754 TGTTGGAAACAGCCTGAGCAAGG + Intergenic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1141413720 16:83854107-83854129 AGTAGAACACAGGCTCAGGACGG + Intergenic
1142037729 16:87872237-87872259 TGTTGCAAACAGCCTTAAAAAGG - Intergenic
1144274031 17:13647634-13647656 TATACCAAACAGTGTCAGGAGGG + Intergenic
1147644788 17:42027199-42027221 TGCAGCAAAAAGCTTGAGGATGG - Intronic
1149398742 17:56271861-56271883 AGAAGGAAACAGCCTCAGGGAGG - Intronic
1150137870 17:62705493-62705515 TTTAGCAAACACCCTCAAAATGG + Intronic
1151993390 17:77593179-77593201 TGGAGCAAACAGCCTCCCAAGGG + Intergenic
1152176101 17:78788599-78788621 TGTAGCACACAGGGTCAGGGTGG - Intronic
1152706620 17:81846847-81846869 TCCAGCAGGCAGCCTCAGGAAGG + Intronic
1153075149 18:1154633-1154655 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
1155210131 18:23593342-23593364 TGTAGCCAACACCCAGAGGAAGG + Intergenic
1155282311 18:24252072-24252094 TCTAGGAAACAGCCTCAAAAGGG + Intronic
1156105820 18:33659104-33659126 TGTAGCAGTTACCCTCAGGAAGG + Intronic
1156973061 18:43181376-43181398 TGTCACGAACAGCCTAAGGAAGG - Intergenic
1157831356 18:50859697-50859719 TGTAGCAGGGAGCTTCAGGAAGG - Intergenic
1160899919 19:1422489-1422511 TGTAGCAAACAGCCTCAGGAAGG + Intronic
1162611071 19:11753586-11753608 TCTAGGAAACAGCCTCAAAAAGG - Intergenic
1163818261 19:19481149-19481171 TGTAGGGACCAGCATCAGGAGGG + Intronic
1164525280 19:29008922-29008944 AATAGCAAACAGCCCAAGGAGGG - Intergenic
1164530860 19:29047215-29047237 TGAAGAAAACAGCCTCAGCCAGG - Intergenic
1164719490 19:30422079-30422101 TATAGCAAAAAGCATCAGGAAGG + Intronic
1164918236 19:32069067-32069089 TCTAGAATACTGCCTCAGGATGG - Intergenic
1167615117 19:50528791-50528813 TGCAGGACACAGCCTGAGGATGG + Intronic
1168087709 19:54060554-54060576 GGTAGGAAACAGCCTCTGGGTGG + Intronic
928227120 2:29459945-29459967 TGTAAAAAGCAGCCTCAGAAAGG + Intronic
928378031 2:30792998-30793020 AGTAGGTAACATCCTCAGGAGGG + Intronic
928413691 2:31073744-31073766 TGTGGCAAACAGCCACTGGAGGG + Intronic
928459053 2:31452494-31452516 TGTAGAAAATAGCCTCAAAAGGG + Intergenic
929052745 2:37851873-37851895 GCAAGCAAACAGCCACAGGAAGG - Intergenic
930141722 2:47957423-47957445 TGTAGAAAACAGCCTCAAAAGGG + Intergenic
930216003 2:48698250-48698272 TGAAGGAAGAAGCCTCAGGAGGG - Intronic
930310935 2:49738724-49738746 GGTAGGACAGAGCCTCAGGATGG - Intergenic
931406693 2:61986522-61986544 TTTAGAAAACAGCCTCAAAAGGG - Intronic
931747388 2:65301926-65301948 TGGGGCAGACAGCCCCAGGAAGG + Intergenic
936120973 2:109744520-109744542 TGGAGTAAACAGCCACAGAATGG - Intergenic
936223722 2:110626955-110626977 TGGAGTAAACAGCCACAGAATGG + Intergenic
937282157 2:120725974-120725996 TGTAACAAAAAACCACAGGATGG + Intergenic
937552018 2:123106442-123106464 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
938177782 2:129152004-129152026 TGTAGAAAATAGCCTCAAAATGG - Intergenic
938692639 2:133806514-133806536 TGTATCCAACATCTTCAGGAAGG + Intergenic
939191909 2:138926288-138926310 AGTAGCAAACAGTGTCTGGAAGG + Intergenic
939800592 2:146701935-146701957 TCTAGAAAATAGCCTCAGAAGGG + Intergenic
940429613 2:153574491-153574513 TCTAGAAAATAGCCTCAGAAGGG - Intergenic
940468826 2:154066227-154066249 TCTAGAAAATAGCCTCAGAAGGG + Intronic
940795567 2:158073338-158073360 TCTAGAAAACAGCCTCAAAAGGG + Intronic
940803202 2:158155587-158155609 TGTAGAAAATAGCCTCAAAAGGG + Intergenic
941010193 2:160290892-160290914 TGGAGCTCACAGTCTCAGGAAGG - Intronic
942352498 2:175066923-175066945 TCTAGAAAACAGCCTCAATAGGG + Intergenic
943915723 2:193629372-193629394 TCTAGAAAATAGCCTCAGAAGGG + Intergenic
944133088 2:196368617-196368639 TCTAGAAAACAGCCTCAAAAGGG - Intronic
944616210 2:201463732-201463754 TCTAGAAAACAGCCTCAAAAGGG - Intronic
944751792 2:202716652-202716674 TCTAGAAAATAGCCTCAGAAGGG - Intronic
945782660 2:214195699-214195721 AGTAGAAAACAGAATCAGGAGGG + Intronic
946951065 2:224875912-224875934 TGGAACAAACAGCCCCAGGATGG + Intronic
947312172 2:228816835-228816857 TGTAGAAAATAGCCTCAAAAGGG - Intergenic
1168989214 20:2079893-2079915 TATAGCAAACAGAGGCAGGATGG + Intergenic
1169790137 20:9401569-9401591 TGTTGCAAATAGCGTCAAGAAGG + Exonic
1170273335 20:14553382-14553404 ACTAGAAAACAGCCTCAGGCAGG - Intronic
1171392706 20:24811700-24811722 TGAAGCAGACAGTGTCAGGAGGG - Intergenic
1176875300 21:14121012-14121034 TTTACCAAACTGCCTCAGGCTGG + Intronic
1177121904 21:17147526-17147548 TCTAGAAAACAGCCTCAAAAGGG + Intergenic
1177275820 21:18911996-18912018 TCTAGAAAACAGCCTCAATAGGG - Intergenic
1177578078 21:22983762-22983784 TGTAGCCATCTGTCTCAGGAAGG - Intergenic
1179377848 21:40867468-40867490 TGTAGCACAGAGCCAGAGGAAGG - Intergenic
1179910713 21:44446424-44446446 TGTAGCAAAATGCCACAGGCCGG + Intergenic
1180198073 21:46209147-46209169 TGCTGCAAACAGTCTCAGGAGGG + Intronic
1180644636 22:17328504-17328526 GGTAGAAAACAGTCTGAGGAAGG + Intergenic
951972927 3:28468312-28468334 TCTAGAAAATAGCCTCAAGAGGG + Intronic
952222141 3:31333603-31333625 TTTAGAAAACAGCCTCAAAAGGG + Intergenic
955298909 3:57758050-57758072 TGTAATTAAAAGCCTCAGGAGGG + Intronic
956896065 3:73661184-73661206 ACTATCAAACAGCCTCAGGTAGG - Intergenic
958143788 3:89598078-89598100 TGCAGAAAACAGCCTAAAGATGG + Intergenic
960915972 3:122695147-122695169 TGTAGGGAAAACCCTCAGGAGGG + Intronic
961610680 3:128134882-128134904 TCTAGCAAATAGCCTCAAAAGGG + Intronic
963179676 3:142340425-142340447 TCTAGAAAACAGCCTCAAAAGGG + Intronic
963591956 3:147271152-147271174 TGTAGAAAATAGCCTCAACAAGG + Intergenic
964127739 3:153253651-153253673 CCTATCAAACAGCCTCAGGCAGG - Intergenic
964368410 3:155973321-155973343 TGTACCAAAATGCCTCAGGCTGG + Intergenic
964419821 3:156489846-156489868 TGTACCACACAACCTCAGGATGG + Intronic
964686976 3:159405963-159405985 TCTAGAAAATAGCCTCAAGAGGG + Intronic
965654176 3:170966234-170966256 AGAAACAAACGGCCTCAGGAAGG + Intergenic
965856726 3:173098212-173098234 AGTGGCAAACAGATTCAGGATGG - Intronic
966121608 3:176527937-176527959 TGTTCCAGACAGCCTCAGCAGGG - Intergenic
966468283 3:180257157-180257179 TCTAGCAAATAGCCTCAAAAGGG + Intergenic
969525613 4:7702504-7702526 CTTGGCAAACAGCCCCAGGATGG - Intronic
973327273 4:48876485-48876507 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
973793331 4:54397920-54397942 TGTAGCAGACAGGCTCTGCAAGG + Intergenic
974301178 4:60068737-60068759 TCTAGAAAATAGCCTCAAGAGGG + Intergenic
974823844 4:67101846-67101868 TGAAGCTAGCAGCCTCAGGAAGG - Intergenic
975704934 4:77102369-77102391 TTTAGCACACAACCCCAGGAAGG + Intergenic
980515569 4:133854163-133854185 AGTATCAAACAGCCTCAGGCGGG + Intergenic
982615465 4:157635112-157635134 TCTAGCAAACAGCCTCAAAAGGG + Intergenic
983165800 4:164476237-164476259 TGCAGCAAATAGCCTCAACAGGG - Intergenic
983456428 4:167970136-167970158 TGTAGAAAATAGCCTCAAAAGGG + Intergenic
984251735 4:177344163-177344185 TGTAGAAAACAGAATCAGGTCGG - Intronic
984914594 4:184710692-184710714 TTGAGGAAACAGCCTCTGGAAGG - Intronic
989083108 5:37647009-37647031 TCTAGAAAACAGCCTCAAAAGGG - Intronic
991557457 5:67911582-67911604 TGTAGCAAAGAGCATCAGGGTGG - Intergenic
991569748 5:68041584-68041606 GGGAGCAAAAAGGCTCAGGAGGG - Intergenic
991917228 5:71617021-71617043 TGTAGCAAATAGTAACAGGAGGG - Intronic
992587400 5:78254209-78254231 TCTAGAAAACAGCCTCAAAAGGG + Intronic
993709421 5:91209608-91209630 TCTACAAAACAGCCTCAGGTAGG - Intergenic
993788499 5:92175639-92175661 TTTAGAACATAGCCTCAGGATGG + Intergenic
994085884 5:95758631-95758653 TCTGGCGATCAGCCTCAGGAAGG + Intronic
995088360 5:108141708-108141730 TGAAGCAAACAGGTTCAGGTGGG - Intronic
995101952 5:108322186-108322208 TGTAGGAGACAGTCTCAGGATGG - Intronic
995207830 5:109502954-109502976 GGTAGGAAACAGCCTTAGGAAGG + Intergenic
996142777 5:119933104-119933126 TATAGCAAACAGCCTTGGAAGGG + Intergenic
996653487 5:125912138-125912160 TGTAGAAAACAGGCTCAAAAGGG - Intergenic
997482175 5:134194233-134194255 TTTAGCAAATAGCCTTATGAAGG - Intronic
997812827 5:136988749-136988771 GGAAGGAAACAGCCTCAGGAAGG - Intronic
998044345 5:138974259-138974281 TGAAGCTAACAGCCACAGGCAGG - Intronic
998591446 5:143483002-143483024 TGTAGCAACCAGCCTCAGAGTGG - Intergenic
1001595838 5:172898275-172898297 GTTCTCAAACAGCCTCAGGAGGG + Intronic
1003488007 6:6596054-6596076 TGTAGCAAACATCAGCAGCATGG - Intronic
1006018327 6:31101161-31101183 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
1007001433 6:38317634-38317656 TCTAGAAAATAGCCTCAGAAGGG - Intronic
1007022112 6:38530984-38531006 TCTAGAAAACAGCCTCAAAAGGG + Intronic
1007103232 6:39265570-39265592 TGTGTAAAACAGCCTCAGGCAGG + Intergenic
1007701182 6:43767441-43767463 TGCAGCAAGCAGCCTGGGGAGGG + Intergenic
1009344483 6:62596361-62596383 TGTAGTAGACACCCTCTGGAGGG - Intergenic
1011002600 6:82607733-82607755 TTTAGGAAACAGACTCAGGGAGG + Intergenic
1013715175 6:112951448-112951470 TGTAGCAAACTGGCACTGGATGG - Intergenic
1016457208 6:144243859-144243881 TCTAGAAAATAGCCTCAGAAGGG - Intergenic
1017186750 6:151609205-151609227 AGTAGCAAACATCATCAAGATGG - Intronic
1019923017 7:4174734-4174756 TGTACCAGACAGCCTCAGCGTGG + Intronic
1022971819 7:35525555-35525577 CGTAGCAATCAGATTCAGGATGG + Intergenic
1024568091 7:50700417-50700439 TGTAGCACAGACACTCAGGAGGG - Intronic
1025718357 7:63984768-63984790 TGTAGAAAATATCCTCAAGAGGG + Intergenic
1027960181 7:84936156-84936178 TGTATAAAACAGCCTCAGGCAGG - Intergenic
1028339198 7:89696575-89696597 TCTAGAAAACAGCCTCAAAAGGG + Intergenic
1028848017 7:95504545-95504567 TGTGGCAAAAATCCTCAGGGTGG - Intronic
1030083646 7:105799007-105799029 TGGACCAAATAGCCTCAGGAGGG + Intronic
1030476608 7:110042421-110042443 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
1032489462 7:132313314-132313336 TGTAGCAAAAAAGTTCAGGAAGG - Intronic
1032802448 7:135327807-135327829 GGTAGCAAGCAGCCACAGGAAGG - Intergenic
1033449428 7:141449456-141449478 TGTGACAAAAAGCCTCAAGAGGG - Intronic
1033509460 7:142040498-142040520 TATATCAAATAGCCTCAGCATGG + Intronic
1034581617 7:152048768-152048790 TCTAGAAAACAGCCTCAAAAAGG - Intronic
1038337442 8:26656719-26656741 TCTAGCACACATCCTCATGATGG - Exonic
1038750362 8:30289370-30289392 TATAGCTCACAGCCTCAGCATGG + Intergenic
1041464306 8:58143566-58143588 TGTGGCAGACACCCTCAAGACGG - Intronic
1042726704 8:71887067-71887089 TCTAGAAAACAGCCTCAAAAGGG - Intronic
1045506264 8:102780952-102780974 GGTAGGAGACAGCCTCAGGGAGG + Intergenic
1047882773 8:129214949-129214971 TGAAGCAAATAGTCTCATGAGGG + Intergenic
1047936079 8:129780119-129780141 TGTAGAAAATAGCCTCAAAAGGG + Intronic
1048985963 8:139735076-139735098 TGCAGCAGACAGCATCAAGACGG + Intronic
1049751274 8:144285406-144285428 TGGAGGAAACAGCGACAGGAGGG + Intronic
1049867616 8:144949163-144949185 CATAGCAAGCAGCCACAGGATGG + Intronic
1050078918 9:1894246-1894268 TGTACCAAGAGGCCTCAGGAGGG + Intergenic
1052258591 9:26489168-26489190 TGTAGAAAATAGCCTCAAAAGGG - Intergenic
1052709390 9:32034827-32034849 TGTAGCAAACTGCTTCAAAAAGG - Intergenic
1053281663 9:36824213-36824235 TGAGGGACACAGCCTCAGGAGGG + Intergenic
1055088742 9:72340862-72340884 TGTAACAAATTGCCACAGGATGG - Intergenic
1057529544 9:95831909-95831931 CTGAGAAAACAGCCTCAGGAAGG - Intergenic
1057918611 9:99077056-99077078 TGTGGCTATCAGCCTCAGGAGGG - Intergenic
1058558289 9:106195041-106195063 TGTAGGAAATAGCCTCAAAAGGG - Intergenic
1060294594 9:122334628-122334650 TTTAGCAAACGGGCTCAGAAAGG + Intergenic
1060969535 9:127730346-127730368 TGCAGCAGACAGCCCCAGCAGGG - Intronic
1203695886 Un_GL000214v1:96537-96559 TGTAGAGATCAGCCTCTGGATGG + Intergenic
1203640387 Un_KI270751v1:7526-7548 TGTAGAGATCAGCCTCTGGATGG - Intergenic
1187315051 X:18185151-18185173 TCTAGAAAACAGCCTCAAAATGG + Intronic
1188845303 X:35065096-35065118 TGTAGCAAGCAGTCTAAGGTAGG - Intergenic
1189331727 X:40148360-40148382 TAAAGCCAACAGCCTCGGGAGGG - Intronic
1190038040 X:47044024-47044046 TGTAGAAAATAGCCTCAGAAGGG + Intronic
1190374161 X:49773303-49773325 TGTAGAAAACAGCTTCGAGAGGG - Intergenic
1192045842 X:67673421-67673443 TCTAGAAAACAGCCTCAAAAGGG - Intronic
1192796767 X:74429954-74429976 TGAAGCACACAGCCTAATGATGG + Intronic
1192839024 X:74834945-74834967 TCTAGAAAACAGCCTCAACAGGG - Intronic
1194229411 X:91302995-91303017 TGTAGAAAATAGCCTCAAAAGGG + Intergenic
1194236074 X:91384423-91384445 TCTAGAAAACAGCCTCAAAAAGG + Intergenic
1194253343 X:91604586-91604608 TCTAGCAAATAGCCTCAAAAGGG + Intergenic
1195559269 X:106264913-106264935 TCTAGAAAATAGCCTCAGAAGGG - Intergenic
1196232309 X:113238508-113238530 TCTAGAAAATAGCCTCAAGATGG - Intergenic
1197052412 X:122076042-122076064 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
1197139410 X:123099539-123099561 TGTAGAAAACAGCCTCAAAGGGG + Intergenic
1197492156 X:127130507-127130529 TTTAGAAAACAGCCTCAAAAGGG + Intergenic
1197602451 X:128546713-128546735 TCTAGAAAATAGCCTCAGAAGGG - Intergenic
1197686537 X:129445099-129445121 AGTAGAAAACAGCCTAATGAGGG - Intergenic
1198702404 X:139412429-139412451 TTTAGAAAACAGCCTCAAAAGGG - Intergenic
1199303677 X:146241836-146241858 TGGAGTAAACAGCATCAGGTAGG - Intergenic
1199522714 X:148754449-148754471 TGTAGCAAAGACCATCAGGAAGG + Intronic
1200379645 X:155821176-155821198 TGTAGAAAATAGCCTCAAAAGGG + Intergenic
1202048709 Y:20759289-20759311 GGTAGCAAATAGCCAAAGGATGG + Intronic