ID: 1160903630

View in Genome Browser
Species Human (GRCh38)
Location 19:1441458-1441480
Sequence GGCCCACAACAGCCTCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 265}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160903623_1160903630 -3 Left 1160903623 19:1441438-1441460 CCCCACCTTCACCCTCAAATGGC 0: 1
1: 1
2: 2
3: 15
4: 266
Right 1160903630 19:1441458-1441480 GGCCCACAACAGCCTCCTGTGGG 0: 1
1: 0
2: 2
3: 31
4: 265
1160903624_1160903630 -4 Left 1160903624 19:1441439-1441461 CCCACCTTCACCCTCAAATGGCC 0: 1
1: 0
2: 7
3: 46
4: 525
Right 1160903630 19:1441458-1441480 GGCCCACAACAGCCTCCTGTGGG 0: 1
1: 0
2: 2
3: 31
4: 265
1160903620_1160903630 30 Left 1160903620 19:1441405-1441427 CCAGGCAGATGGGGGCAGGGGAG 0: 1
1: 0
2: 6
3: 83
4: 660
Right 1160903630 19:1441458-1441480 GGCCCACAACAGCCTCCTGTGGG 0: 1
1: 0
2: 2
3: 31
4: 265
1160903625_1160903630 -5 Left 1160903625 19:1441440-1441462 CCACCTTCACCCTCAAATGGCCC 0: 1
1: 0
2: 4
3: 25
4: 290
Right 1160903630 19:1441458-1441480 GGCCCACAACAGCCTCCTGTGGG 0: 1
1: 0
2: 2
3: 31
4: 265
1160903626_1160903630 -8 Left 1160903626 19:1441443-1441465 CCTTCACCCTCAAATGGCCCACA 0: 1
1: 0
2: 5
3: 42
4: 415
Right 1160903630 19:1441458-1441480 GGCCCACAACAGCCTCCTGTGGG 0: 1
1: 0
2: 2
3: 31
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160903630 Original CRISPR GGCCCACAACAGCCTCCTGT GGG Intergenic
900320274 1:2080075-2080097 GGCCCAGTACAGTCTCCTGGTGG + Intronic
900357385 1:2271379-2271401 GCTCCATAACAGGCTCCTGTGGG - Intronic
900531832 1:3157714-3157736 GGCCAAACACAGCCTCCTGTGGG - Intronic
900695927 1:4010433-4010455 GCCCCACCACAGCCTCCTCCAGG - Intergenic
900759371 1:4460752-4460774 GGCCCTCCCCAGCCTCCGGTGGG - Intergenic
903296723 1:22348397-22348419 GGACCACAACAGCCTCCTCCTGG - Intergenic
903705060 1:25279606-25279628 AGCCCACAACAGCCTCAGGTAGG - Intronic
903722167 1:25413715-25413737 AGCCCACAACAGCCTCAGGTAGG + Intronic
904479626 1:30785757-30785779 GGCCAGCAACACCCTCCTGCGGG - Intergenic
906143494 1:43546957-43546979 TGCACGCAACAGCCTCCTGACGG + Intronic
906215038 1:44033779-44033801 GGCCCAAACCTGCCTCCTTTGGG - Intergenic
907249819 1:53130585-53130607 GGAGCACCACAGCCTCCTGCTGG + Intronic
907550305 1:55299348-55299370 GGCCCACACACGCCTCCTTTCGG + Intergenic
908824174 1:68117444-68117466 GGACCACACGAGCCTCCTGTTGG - Intronic
911378834 1:97086844-97086866 GACCCAGAACAGCATGCTGTGGG + Intronic
913424871 1:118716952-118716974 GGCACACCACAAGCTCCTGTGGG - Intergenic
915061527 1:153189900-153189922 GCCCCACAAAAGCCTCCTGTAGG + Intergenic
916787648 1:168098077-168098099 GGGTCACAGCAGGCTCCTGTTGG + Intronic
922100107 1:222472526-222472548 GGCCCCAAACAGCCTCCGGTCGG - Intergenic
922222844 1:223621607-223621629 GCCACACATGAGCCTCCTGTAGG - Intronic
922734912 1:227973659-227973681 GGCCCCAAACGGCCTCCGGTCGG + Intergenic
923318784 1:232807399-232807421 TGTCAACAACAGCATCCTGTTGG - Exonic
924343306 1:243054191-243054213 GGCCCCAAACGGCCTCCGGTCGG - Intergenic
1062920215 10:1273769-1273791 GCCCCACCACAGGCTCCTGCAGG + Intronic
1066270638 10:33819616-33819638 AGCTCACAAGAGCCTCCTCTAGG + Intergenic
1067085200 10:43234520-43234542 GGTCCTCATCAGCCCCCTGTGGG - Intronic
1072715996 10:97753031-97753053 CGCCCTCATCATCCTCCTGTGGG - Exonic
1076365895 10:129920951-129920973 GGCTCACAACAGCCTTCTGGTGG - Intronic
1076735360 10:132456584-132456606 GCCTCAGAACAGCCTCCTGGAGG - Intergenic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1077109550 11:856037-856059 GGCCCCCTTGAGCCTCCTGTAGG - Intronic
1077362191 11:2145670-2145692 GGGCCACTACACCCTGCTGTGGG - Intronic
1078422490 11:11223942-11223964 CACCCACAACAGGCCCCTGTAGG - Intergenic
1083221993 11:61258706-61258728 GGCCCCCAGCAGCCCCCAGTGGG - Exonic
1083630309 11:64091816-64091838 GGGCCTCAGCAGCCTCCTGGGGG - Intronic
1083821182 11:65172307-65172329 GGCCAAGAACAGGCTGCTGTGGG - Exonic
1085876028 11:80406604-80406626 AGCCCACAAAAGCCTCCCTTAGG + Intergenic
1089169271 11:116500830-116500852 GGCCCGCATCAGCCTCCGGAAGG + Intergenic
1089707718 11:120292524-120292546 GGGGCAGAACAGCCTTCTGTGGG + Intronic
1089775376 11:120832009-120832031 GTCCCACACCATCCTCCTGAAGG + Exonic
1092244387 12:6855394-6855416 GGCCCCCCTCAGACTCCTGTGGG - Exonic
1093561419 12:20546055-20546077 AGACCACATCAGCCTCGTGTGGG - Intronic
1096755072 12:53792531-53792553 GCCCCACCACTGCTTCCTGTTGG + Intergenic
1099584370 12:84497997-84498019 TGCCCACTAGAGCCCCCTGTTGG + Intergenic
1102027399 12:109721287-109721309 GGCCCAGAACAGCGTCCCCTCGG - Intronic
1102570998 12:113826985-113827007 GGCCCCCAACTGCCCCCTGGAGG + Intronic
1103714580 12:122936952-122936974 CTCCCACATCAGCCTCCTGAGGG - Intronic
1104635295 12:130434696-130434718 GCCCCACACCATCCTCCTGGTGG - Intronic
1104674849 12:130705457-130705479 GGGCCACAGAAGCCTCCTGGGGG + Intronic
1105600731 13:21884765-21884787 GGCCAAGAACATCCTCCTGAAGG - Intergenic
1106549879 13:30761949-30761971 AGCCCACAACACCCTCTTTTGGG + Intronic
1109221331 13:59643826-59643848 GTCCTTCAACAGCATCCTGTCGG + Intergenic
1110707723 13:78613812-78613834 GGCCCACTGCAGCCTCGGGTGGG - Intergenic
1113743113 13:112724694-112724716 GGCCCCAAACAGCTTCCTGGGGG - Intronic
1113776702 13:112951699-112951721 GGGCCACAAGAGGGTCCTGTGGG + Intronic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1115501058 14:34050227-34050249 GCACCACAACAGCCTCTGGTTGG - Intronic
1116330954 14:43597142-43597164 GGCTCACACCAGCTTTCTGTTGG - Intergenic
1116720544 14:48490198-48490220 GGCCCACAACTGCATCCTAAAGG + Intergenic
1120063873 14:80017221-80017243 GTCCCATAACAGCTTGCTGTGGG + Intergenic
1121604458 14:95230455-95230477 GTCCCATTACAGCCTCTTGTGGG - Intronic
1121727888 14:96166309-96166331 AGCCCACATCAGTCTCCTGTTGG - Intergenic
1122190436 14:100038439-100038461 TGCCCACCACTGCCTCCTCTCGG + Intronic
1122405464 14:101498253-101498275 GGCCCAGAACACCCTCTTGAAGG - Intergenic
1122694446 14:103545952-103545974 GGCCCCAAACAGCTTCCTGAGGG + Intergenic
1122799054 14:104220820-104220842 GGCCCACGACAGCTCCCTCTCGG - Intergenic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202860687 14_GL000225v1_random:79433-79455 GGCCCACGAAAGCCCCCTGAGGG + Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202864269 14_GL000225v1_random:104948-104970 GTCTCACAAAAGCCCCCTGTGGG + Intergenic
1124258309 15:28163992-28164014 GGCACACAGAAGCCTCCTGGAGG + Intronic
1125841009 15:42801224-42801246 GCCCTCCAACAGCTTCCTGTAGG + Intronic
1132773264 16:1576865-1576887 GGCCCACATCGTGCTCCTGTCGG + Intronic
1132891918 16:2208826-2208848 GGCAGACAACAGCCTTCTGGTGG - Exonic
1134691884 16:16196463-16196485 GGCACACAACTGCACCCTGTAGG - Intronic
1134693527 16:16206503-16206525 GCCACACAACAGCCACCTGCTGG - Intronic
1134978324 16:18588197-18588219 GCCACACAACAGCCACCTGCTGG + Intergenic
1136496472 16:30648111-30648133 GGCCCCACACAGCCTCCAGTGGG - Intergenic
1137893132 16:52183182-52183204 GGTCCATAAAAGCCTCCTATAGG - Intergenic
1139046056 16:63061534-63061556 GTCCCACAGCAGCCTCCAGGTGG + Intergenic
1141162502 16:81638733-81638755 GCCCCAGTTCAGCCTCCTGTGGG + Intronic
1141687863 16:85580553-85580575 GGGACACCGCAGCCTCCTGTTGG + Intergenic
1142354218 16:89594492-89594514 AGCCCACAGCAGCCTCCCCTGGG - Intronic
1142450623 16:90171324-90171346 GGCCCCAAACGGCCTCCGGTCGG + Intergenic
1148244038 17:46018859-46018881 GGCCCTCAGCAGCATCCAGTGGG + Intronic
1148782787 17:50130815-50130837 GGCCCTCAATAGCCTCCAGCGGG - Intergenic
1151348232 17:73516311-73516333 GGGCCACAGCAGCCTCCTCCTGG - Intronic
1152379718 17:79936110-79936132 GGCCCACACCACCCTTCTGATGG + Exonic
1152400731 17:80064902-80064924 GGCCCAGCACCGCTTCCTGTAGG - Intronic
1152889791 17:82873975-82873997 GCCCCTGCACAGCCTCCTGTTGG + Intronic
1157114597 18:44851255-44851277 GGCCCAGGAAAGCTTCCTGTAGG + Intronic
1157522397 18:48354385-48354407 TGCTCACAATAGTCTCCTGTTGG + Intronic
1160037071 18:75311157-75311179 GCCACACATCAGCCTCCTCTGGG + Intergenic
1160089831 18:75816393-75816415 GGACAGCAGCAGCCTCCTGTTGG - Intergenic
1160903630 19:1441458-1441480 GGCCCACAACAGCCTCCTGTGGG + Intergenic
1161080971 19:2309952-2309974 CGCCCCCCACAGCATCCTGTGGG - Intronic
1161478483 19:4498987-4499009 GGCCCCCAGCAGGTTCCTGTCGG + Intronic
1161570960 19:5030719-5030741 GGCCCACAACTGCCCCTCGTGGG + Intronic
1163312820 19:16524173-16524195 GGCTCACTGCAGCCTCCTCTTGG - Intronic
1163694749 19:18758443-18758465 GGCCCACAATAGGCTCCTCTTGG - Intronic
1164615858 19:29666356-29666378 AGCTCACAACAGACTCCAGTGGG - Intronic
1164777812 19:30867254-30867276 GGCCAACAGAAGCCTCATGTTGG - Intergenic
1166045357 19:40226642-40226664 CGCCCGCAACACCCTCCTGGAGG - Exonic
927451785 2:23215085-23215107 GGCCCACAAGCCCCTCCTATGGG - Intergenic
928451365 2:31381357-31381379 GGCTCACCACAGCCTGCTGTTGG - Intronic
928575397 2:32649457-32649479 GCCCCACAAGAACCCCCTGTGGG - Intronic
929626724 2:43416520-43416542 GGCCTACTACAGCCTACTGTAGG + Intronic
930163673 2:48182941-48182963 GGTCCACAACAGTCTCTTCTCGG + Intergenic
936029313 2:109058823-109058845 TGCCCCCATTAGCCTCCTGTGGG - Intergenic
937099057 2:119254689-119254711 GGCCAACAAGAGCCACCTCTGGG + Exonic
937224361 2:120359793-120359815 GGCCCACAGCATAATCCTGTAGG - Intergenic
937326874 2:120994829-120994851 GGCCTACAGCAGCCTGATGTGGG - Intergenic
940047691 2:149426915-149426937 GGCCCAAAACACCTTCCAGTGGG + Intronic
942900137 2:181106364-181106386 GTCATGCAACAGCCTCCTGTCGG + Intergenic
946307744 2:218865745-218865767 GGCCCAGGACAGTCTCCTGGGGG + Intronic
946359685 2:219211710-219211732 AGCTCACTACAGCCTCCTGGTGG + Intronic
946505267 2:220293627-220293649 GGCACACAAAAGCCTCCCTTTGG + Intergenic
948730422 2:239959985-239960007 GGCACTCCACAGCCGCCTGTGGG - Exonic
948855714 2:240729647-240729669 GGCCCACAACAGCCCCCTTGGGG + Intronic
948869925 2:240792660-240792682 GGCCCACAGCAGGCTCCGTTGGG - Intronic
949036139 2:241816541-241816563 GGTCTACAGCAGCCTCCTCTGGG - Exonic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1172025435 20:31945287-31945309 GGCTCACCACAGCCATCTGTGGG - Exonic
1172654202 20:36526917-36526939 GGCCCGCAAGAGACTCCTGGCGG + Exonic
1172806535 20:37615823-37615845 GGCCCACAACTGCCTGCTGCAGG - Intergenic
1174271311 20:49371373-49371395 GGCCAACAACACCATGCTGTTGG + Exonic
1175168365 20:57062465-57062487 GCCCCACAACAGCATCCAGGAGG + Intergenic
1175216643 20:57394784-57394806 GGCCCACAGCAGGCGCCTGGGGG + Intronic
1175778630 20:61668471-61668493 GCCCCACGACAGCCTCCAGCAGG - Intronic
1175899877 20:62355738-62355760 GGGCCTCAGCAGCCCCCTGTGGG + Intronic
1178792673 21:35714455-35714477 GGCCCAGCACAGCCTCCACTGGG + Intronic
1178877334 21:36423095-36423117 AGCCCATCACATCCTCCTGTGGG - Intergenic
1179975611 21:44864183-44864205 GGCAGAAAACAGCATCCTGTGGG - Intronic
1179985880 21:44919986-44920008 TCCCCACAACAGGCTCCTGGAGG - Intronic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180801959 22:18636135-18636157 GGCCCACAGCAGCCTCTTAAGGG - Intergenic
1180853194 22:19031676-19031698 GGCCCACAGCAGCCTCTTAAGGG - Intergenic
1181219761 22:21359126-21359148 GGCCCACAGCAGCCTCTTAAGGG + Intergenic
1181778638 22:25177819-25177841 GTCCCACAAAAGCCACATGTGGG + Intronic
1183061481 22:35338850-35338872 GGCCCACAACGGCACCCAGTGGG - Intronic
1183359455 22:37375912-37375934 GGCACTCTCCAGCCTCCTGTGGG - Exonic
1183513060 22:38247073-38247095 AGCCCACATCAGCCTCCTCTGGG + Intronic
1184870179 22:47232860-47232882 GGCCCAGAACAGCCCCCGGTGGG - Intergenic
1184872898 22:47252062-47252084 GGGCCACAACTGTCTCCTCTGGG + Intergenic
1185050604 22:48552217-48552239 GGTCCACACTTGCCTCCTGTGGG + Intronic
1185318789 22:50190779-50190801 TGCTCACAACAGCTTCCGGTGGG + Intronic
950097636 3:10339175-10339197 AGCCCCCAAGAGCCTCCTGTAGG + Intronic
951061269 3:18209741-18209763 GTCCCACAGCAGCTTCCTCTTGG + Intronic
951440278 3:22714967-22714989 GGTTCACAATAGCCTCCTCTTGG + Intergenic
953026853 3:39150445-39150467 CGCCCTCAGCAGCCTCATGTGGG - Intronic
953413253 3:42701861-42701883 GGGCCACATCAGCCACCTCTTGG - Intronic
954009325 3:47621055-47621077 TGCCCACCTCAGCCTCCTGAAGG - Intronic
954672316 3:52297683-52297705 GGCCCACCACTGCCTCCTTGGGG + Intergenic
955202248 3:56861694-56861716 GGCCCTGAACAGCCTCCTGAGGG - Intronic
955491939 3:59491604-59491626 ACCCCACAACAGGCCCCTGTGGG + Intergenic
959468017 3:106714104-106714126 GGCCCAAAACAGCTTCCTGCTGG - Intergenic
960841373 3:121962885-121962907 GGACCACTTCAGCCTCCAGTTGG - Intergenic
961020140 3:123498417-123498439 GGTCCCCAACCGCCACCTGTTGG + Intronic
961222449 3:125211845-125211867 GCCCCAAAACAGCCTCCTCATGG - Intronic
961795482 3:129405839-129405861 GGCACACAGGAGCATCCTGTGGG - Intronic
962031425 3:131604705-131604727 GTCCCACAACAGCCATCTGCAGG - Intronic
965714694 3:171590028-171590050 GGCCATTAACAGCCTCCTATGGG - Intergenic
966451210 3:180064195-180064217 TGCCCACAAAAGCCTCATTTTGG - Intergenic
967738744 3:192982342-192982364 TGCCCTCATCAGCCTCCCGTTGG + Intergenic
968548990 4:1212875-1212897 GGCCCAGAACAGCCTCCAGGAGG - Intronic
968742010 4:2335832-2335854 GGCCCACCACAGCCACAGGTTGG + Intronic
968822231 4:2863119-2863141 GGCCCACTACAGCCTCTACTAGG + Intronic
969262810 4:6044238-6044260 GGACCACATTTGCCTCCTGTTGG + Intronic
969346451 4:6573630-6573652 GGCCCCTAACAACCTCCTGTGGG - Intergenic
969611486 4:8229788-8229810 CCCCCACAGCAGCCTCCGGTGGG + Intronic
969810341 4:9642631-9642653 GGACCACGATTGCCTCCTGTAGG + Intergenic
970094164 4:12443667-12443689 GGTCCACAATTGCCTCCTATGGG - Intergenic
973934328 4:55827780-55827802 GGCATACAACTGCCTCCTGGTGG + Intergenic
973957435 4:56076696-56076718 GGGCCAGAAAAGCCTCCTGGAGG - Intergenic
974565586 4:63575741-63575763 GGCCCAGCTCAGCATCCTGTAGG - Intergenic
976774966 4:88697990-88698012 GGCCCTCAACACCCGCCTGTTGG + Exonic
976825555 4:89256567-89256589 GCACTACATCAGCCTCCTGTCGG - Intronic
976874460 4:89836898-89836920 GGCTCACAGCGGCCTCCTCTGGG - Intronic
979259506 4:118634285-118634307 GGCCCCAAACGGCCTCCGGTTGG + Intergenic
979328850 4:119406277-119406299 GGCCCCAAACGGCCTCCGGTCGG - Intergenic
981014681 4:139961497-139961519 GGCCCACAACAGGCTCATTGTGG - Intronic
982054296 4:151532471-151532493 GTGCCACAAGAGCCTCCTGGAGG + Intronic
982969065 4:161957568-161957590 TGCCCACAACAGCTTGCTGAAGG + Intronic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
986646651 5:9922893-9922915 GGCCCACTACTGCCTCCTGGTGG + Intergenic
987388271 5:17351097-17351119 CTTCCACAAGAGCCTCCTGTTGG + Intergenic
993624215 5:90204848-90204870 GGTACACAACTGCCTGCTGTGGG - Intergenic
995197139 5:109383815-109383837 CTCCCACCACAGCCTCCTGAGGG - Intronic
996623597 5:125541196-125541218 AGCCAATCACAGCCTCCTGTGGG - Intergenic
1001435530 5:171696352-171696374 AGCCCACATCAGCCTGCTGTGGG + Intergenic
1001772959 5:174309514-174309536 GGCCTCCAGCAGCCTCCTTTTGG + Intergenic
1004769627 6:18767441-18767463 GGCTAACAGCAGCCTGCTGTTGG + Intergenic
1005847038 6:29790035-29790057 GGCCCCCAACAGCCACCTCCCGG + Intergenic
1006309113 6:33244846-33244868 GGCTCACCACAACCTCCTCTGGG + Intergenic
1007078434 6:39082558-39082580 GGACCAGGACTGCCTCCTGTGGG - Intronic
1008704570 6:54142596-54142618 GGCCCACAAGACCCTCCTACAGG - Intronic
1014308793 6:119772679-119772701 GGTCCATAACAGGCTTCTGTGGG - Intergenic
1018503960 6:164443827-164443849 GGCCCACAGCAGCTACATGTGGG - Intergenic
1022387748 7:29917451-29917473 CCCCCAAAAAAGCCTCCTGTAGG + Intergenic
1023401234 7:39793910-39793932 GGCCCCAAACGGCCTCCGGTCGG + Intergenic
1023505640 7:40897634-40897656 GGCCCCCAAGAGCCTTCAGTGGG + Intergenic
1023937325 7:44749026-44749048 GGCCCACACCTGCCTGCTGGCGG - Intronic
1024648379 7:51386771-51386793 GGCCCCAAACGGCCTCCGGTCGG - Intergenic
1024648911 7:51388844-51388866 GGCCCCAAACGGCCTCCGGTCGG - Intergenic
1025052228 7:55741240-55741262 GGCCCCAAACGGCCTCCGGTCGG - Intergenic
1025129185 7:56366923-56366945 GGCCCCCAACGGCCTCCGGTCGG - Intergenic
1025177607 7:56809961-56809983 GGCCCCGAACGGCCTCCAGTCGG - Intergenic
1025690144 7:63749898-63749920 GGCCCCAAACGGCCTCCGGTCGG + Intergenic
1025690591 7:63751721-63751743 GGCCCCAAACAGCCTCCGGTCGG + Intergenic
1025691041 7:63753544-63753566 GGCCCCAAACGGCCTCCGGTCGG + Intergenic
1025691476 7:63755320-63755342 GGCCCCAAACGGCCTCCGGTCGG + Intergenic
1025691916 7:63757143-63757165 GGCCCCAAACGGCCTCCGGTCGG + Exonic
1025692364 7:63758966-63758988 GGCCCCAAACGGCCTCCGGTCGG + Intergenic
1025692808 7:63760789-63760811 GGCCCCAAACGGCCTCCGGTCGG + Intergenic
1025693225 7:63762468-63762490 GGCCCCAAACGGCCTCCGGTCGG + Intergenic
1025693668 7:63764291-63764313 GGCCCCAAACGGCCTCCGGTCGG + Intergenic
1025694149 7:63766278-63766300 GGCCCCGAACGGCCTCCAGTCGG + Intergenic
1026528537 7:71176697-71176719 AGTACACAACAGCCTCCTATAGG - Intronic
1028449340 7:90963304-90963326 TTCCCACATCAGCCTCCTGTGGG - Intronic
1029272555 7:99385717-99385739 GGCCTACCACAGCTTCCTGGTGG + Exonic
1029683348 7:102128080-102128102 GGCCCACTTCAGCCTCCAGAAGG + Intronic
1029985159 7:104916291-104916313 GGCTCAAAAAATCCTCCTGTTGG - Intergenic
1032051732 7:128654275-128654297 GGCCCCAAACGGCCTCCGGTTGG + Intergenic
1032078606 7:128847836-128847858 GGCCCAGCACAGCCACCTGCAGG - Exonic
1032501630 7:132404199-132404221 GCCTCACATCAGCCTCCTGGAGG - Intronic
1032585146 7:133139590-133139612 GGCACTCAGCAGCCACCTGTAGG + Intergenic
1034043516 7:147904073-147904095 GGCAGTCAACAGCCTCCTGCGGG + Intronic
1034330247 7:150276597-150276619 AGCCCTCAACAGCCGCCTGATGG + Intronic
1034493424 7:151406452-151406474 GGCCAACCACAGGCTCTTGTGGG + Intronic
1034493425 7:151406454-151406476 GGCCCACAAGAGCCTGTGGTTGG - Intronic
1034498893 7:151437641-151437663 GGCCCAAATCAGCCTCCCATTGG + Intronic
1035091953 7:156320071-156320093 GGTCCACACCTGCCTCATGTCGG - Intergenic
1035264378 7:157683036-157683058 GGGCCAGCACAGCGTCCTGTGGG - Intronic
1035780522 8:2223925-2223947 GGCACACAGAAACCTCCTGTAGG - Intergenic
1036470274 8:9046821-9046843 GGCCCACATCGGCCTCCCCTTGG + Intronic
1036687089 8:10918921-10918943 GGCCCACCACAGCCTCCAACAGG + Intronic
1037691635 8:21185967-21185989 GGCCAACTCCAGCCTGCTGTGGG + Intergenic
1044236448 8:89836449-89836471 CGCCCACCTCAGCCTCCTGAAGG + Intergenic
1044532498 8:93323499-93323521 TACCCACAACAACCTCTTGTTGG + Intergenic
1047176687 8:122548044-122548066 TGTCCTCAACAGCCTCCTGTGGG + Intergenic
1048444456 8:134482889-134482911 GGTCCCCTGCAGCCTCCTGTTGG + Intronic
1049002098 8:139832713-139832735 TGCCCAGAAGAGCCTCCTGCAGG + Intronic
1049171092 8:141161100-141161122 GTCCCAAAACAGCCACCTGCAGG - Intronic
1049271417 8:141698220-141698242 GCCCCACAGCAGCCTCATGATGG - Intergenic
1049571459 8:143372057-143372079 GGCCCACAGCAGGTGCCTGTGGG + Intronic
1051693307 9:19740909-19740931 GACCCACAACAGCCTCATCATGG + Intronic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1057009869 9:91591369-91591391 TGCCCACAACAGCCAACTATTGG + Intronic
1057303342 9:93898986-93899008 GGACCACCACAGTCTCCTATGGG + Intergenic
1057884512 9:98819779-98819801 GGCCCACCTGAGCCTCCTGTTGG + Intronic
1058365590 9:104204889-104204911 GGTGCACAACAGCTTCCTGTGGG + Intergenic
1059331318 9:113537447-113537469 AGCCCAGAACAGCCTCCCCTGGG - Intronic
1060983631 9:127807622-127807644 CGACCACACCAGCCTCCTGGGGG + Exonic
1061510508 9:131058188-131058210 GGCTCACTGCAGCCTCCTGCTGG + Intronic
1061536369 9:131252634-131252656 TGCCCACACCAGCCTGCTGGGGG - Intergenic
1061600963 9:131669744-131669766 GGCCCTCAGGAGCCTCCCGTGGG - Intronic
1062110256 9:134778367-134778389 GGCTCAGAACAGCCTGCTGCAGG - Intronic
1203740054 Un_GL000216v2:171068-171090 GTCTCACAAAAGCCCCCTGTGGG - Intergenic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1191811828 X:65197188-65197210 GGCCGGCAACAGCCACCTGGCGG + Intergenic
1192358264 X:70423229-70423251 GGACCCACACAGCCTCCTGTAGG + Exonic
1192882759 X:75304640-75304662 GGCCCACAACAGCTTCCTATGGG - Intergenic
1192889795 X:75377756-75377778 GGACCACTACAACCTCCTTTTGG + Intronic
1195368863 X:104153036-104153058 GGCCCTAAACAGACTCCTGGAGG - Intronic
1195469977 X:105219983-105220005 GGCCCAGACCAGCCTCGTGGAGG - Exonic
1196898769 X:120362767-120362789 GAGCCACAGCAGCCTCCTTTAGG - Intronic
1200072895 X:153537731-153537753 GGCCCTCCACAGCCTCCTCGGGG - Intronic
1200163510 X:154020698-154020720 GGCCCACAGCTGGCCCCTGTTGG + Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic
1201179700 Y:11332936-11332958 GGCTCACAAAAGCTCCCTGTGGG - Intergenic
1202381020 Y:24276652-24276674 GGCCCCAAACAGCCTCCGGTTGG + Intergenic
1202489765 Y:25393474-25393496 GGCCCCAAACAGCCTCCGGTTGG - Intergenic