ID: 1160904191

View in Genome Browser
Species Human (GRCh38)
Location 19:1444919-1444941
Sequence GGCAGCTGACCCGCAAGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160904191_1160904195 1 Left 1160904191 19:1444919-1444941 CCGGCGCTTGCGGGTCAGCTGCC No data
Right 1160904195 19:1444943-1444965 TCAGGCCCTGTCCTGGTTCCCGG No data
1160904191_1160904193 -6 Left 1160904191 19:1444919-1444941 CCGGCGCTTGCGGGTCAGCTGCC No data
Right 1160904193 19:1444936-1444958 GCTGCCTTCAGGCCCTGTCCTGG No data
1160904191_1160904201 21 Left 1160904191 19:1444919-1444941 CCGGCGCTTGCGGGTCAGCTGCC No data
Right 1160904201 19:1444963-1444985 CGGCGCTTCTCACATCCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160904191 Original CRISPR GGCAGCTGACCCGCAAGCGC CGG (reversed) Intergenic
No off target data available for this crispr