ID: 1160904322

View in Genome Browser
Species Human (GRCh38)
Location 19:1445394-1445416
Sequence GCGGGAGGTGGGAGCCACCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160904322_1160904331 3 Left 1160904322 19:1445394-1445416 CCGCGGTGGCTCCCACCTCCCGC No data
Right 1160904331 19:1445420-1445442 GCCTGCGCGACCTGCCCCCCGGG No data
1160904322_1160904333 4 Left 1160904322 19:1445394-1445416 CCGCGGTGGCTCCCACCTCCCGC No data
Right 1160904333 19:1445421-1445443 CCTGCGCGACCTGCCCCCCGGGG No data
1160904322_1160904342 30 Left 1160904322 19:1445394-1445416 CCGCGGTGGCTCCCACCTCCCGC No data
Right 1160904342 19:1445447-1445469 CCCAGCCCTCACTGCCCTCGCGG No data
1160904322_1160904330 2 Left 1160904322 19:1445394-1445416 CCGCGGTGGCTCCCACCTCCCGC No data
Right 1160904330 19:1445419-1445441 GGCCTGCGCGACCTGCCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160904322 Original CRISPR GCGGGAGGTGGGAGCCACCG CGG (reversed) Intergenic
No off target data available for this crispr