ID: 1160906526

View in Genome Browser
Species Human (GRCh38)
Location 19:1454017-1454039
Sequence CAGGGCCAGCAGAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1004
Summary {0: 1, 1: 1, 2: 13, 3: 111, 4: 878}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160906516_1160906526 16 Left 1160906516 19:1453978-1454000 CCGTCTTTGTAGAGAGCTGTGGC 0: 1
1: 0
2: 0
3: 11
4: 165
Right 1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG 0: 1
1: 1
2: 13
3: 111
4: 878
1160906521_1160906526 -6 Left 1160906521 19:1454000-1454022 CCCAAGAAGCGTGGGCTCAGGGC 0: 1
1: 0
2: 1
3: 5
4: 142
Right 1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG 0: 1
1: 1
2: 13
3: 111
4: 878
1160906522_1160906526 -7 Left 1160906522 19:1454001-1454023 CCAAGAAGCGTGGGCTCAGGGCC 0: 1
1: 0
2: 1
3: 21
4: 242
Right 1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG 0: 1
1: 1
2: 13
3: 111
4: 878

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160906526 Original CRISPR CAGGGCCAGCAGAGGGAGGC AGG Intronic
900204721 1:1427076-1427098 CAGGGCGGGAAGAGGGAGGGGGG - Intronic
900270576 1:1785216-1785238 CAGGGACAGCTTAGGGAAGCGGG + Intergenic
900387838 1:2418705-2418727 CAGGACCTGCGGAGGCAGGCGGG - Intergenic
900479402 1:2890833-2890855 CAGAGCCTTCAGAGGGAGCCTGG - Intergenic
900511622 1:3063524-3063546 GAGGGCCGGCAGTGGGGGGCAGG + Intergenic
900582950 1:3418357-3418379 CTGCACCAGCAGAGGGTGGCCGG - Intronic
900936268 1:5768177-5768199 TAGTGCCTGCAGAGGGAGCCTGG - Intergenic
901210961 1:7525854-7525876 CACGGTCTGAAGAGGGAGGCAGG + Intronic
901232545 1:7649312-7649334 CAGGCCCCGCAGATGCAGGCAGG - Intronic
901650221 1:10738719-10738741 GAGGGGGAGGAGAGGGAGGCAGG + Intronic
901685288 1:10940389-10940411 CAGGGCCAGTGGAGGCTGGCGGG + Intergenic
901875326 1:12164163-12164185 CAGGGACAGCAGAGGCAGTGTGG - Intergenic
901964979 1:12859194-12859216 CAGCGATACCAGAGGGAGGCAGG - Exonic
901972299 1:12917877-12917899 CAGGGACCCTAGAGGGAGGCGGG - Exonic
902005125 1:13225900-13225922 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902012880 1:13283885-13283907 CAGGGACCCTAGAGGGAGGCGGG + Exonic
902024350 1:13371694-13371716 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902043971 1:13512101-13512123 CAGGGTCACAAGTGGGAGGCTGG + Intronic
902251463 1:15156342-15156364 CCAGGCCTGCAGAGGGAGGGAGG - Intronic
902470003 1:16642725-16642747 CTGGCCCAGCAGAGTGAGGAGGG + Intergenic
902488657 1:16764665-16764687 CAGGCTCAGCTGTGGGAGGCTGG + Intronic
902609392 1:17588289-17588311 CAGGGCTGGGGGAGGGAGGCGGG + Intronic
902658243 1:17884199-17884221 CAGGGGCTGCAGAGGTAGGCAGG + Intergenic
903137591 1:21319525-21319547 TGGGGGCAGCAGAGGGAGTCTGG - Intronic
903213144 1:21829692-21829714 CTGGGCCTGGAGAGTGAGGCAGG - Intronic
903228762 1:21909319-21909341 CAGGGCAGGCAGATGGAGCCTGG + Intronic
903342326 1:22662176-22662198 AAGGCCCAGTAGAGTGAGGCTGG - Intergenic
903516429 1:23913913-23913935 CTGGGCCAGTAGAGAGGGGCAGG + Intergenic
904044635 1:27602350-27602372 AGGGGCCAGCTGAGGGAGGAAGG - Intronic
904052425 1:27647768-27647790 CAGGGCCGGGAGAAGGAGGAGGG + Intergenic
904443089 1:30544781-30544803 CAGGGCCACCAGATGTGGGCTGG - Intergenic
904804041 1:33118503-33118525 CTGTGACTGCAGAGGGAGGCAGG + Intronic
904877561 1:33668186-33668208 CTGGGCCAGGAGAGGTAGGCAGG + Intronic
905016894 1:34783907-34783929 CAGGCCCAGCACAGGGAGCAGGG + Intronic
905610322 1:39344865-39344887 CAGCGACAGCAGAGAAAGGCAGG - Intronic
905793692 1:40803488-40803510 CAGGCCCAGCTGATGGAGGCAGG - Intronic
905798988 1:40831333-40831355 GAGGGCCGGCTGAGGGTGGCAGG + Intronic
906044900 1:42821063-42821085 AGGTGCCTGCAGAGGGAGGCAGG - Intronic
906282427 1:44563408-44563430 CAGGGCCAAGGGAGGGAAGCGGG - Intronic
906290209 1:44614779-44614801 CAGGGACAAGGGAGGGAGGCTGG - Intronic
906671977 1:47662713-47662735 CAGGGTAGGCAGAGTGAGGCTGG - Intergenic
906703557 1:47877447-47877469 AAGGGACAGAAGAGGGAGGGAGG - Intronic
907310210 1:53534770-53534792 GAGGGGCAGCTGAGTGAGGCAGG - Intronic
907323852 1:53622663-53622685 CATGGCCAGGAGACGGATGCTGG + Intronic
907525151 1:55049696-55049718 CATGGCCAGCAGAGGGCAGGTGG - Intronic
907822803 1:57987725-57987747 GAGCGCCAGCAGAGGCAGGCAGG - Intronic
907872679 1:58457198-58457220 GAGGGCCAGGAGAGGCAGGTTGG - Intronic
908359923 1:63358858-63358880 CAGGGCGAGAAGTGGGAGGTGGG + Intergenic
908887649 1:68808518-68808540 TACAGCCAGAAGAGGGAGGCTGG + Intergenic
910208288 1:84769561-84769583 CAGGGCAAGCAGAGTAAAGCTGG - Intergenic
910408636 1:86915724-86915746 AATTGCCAGCTGAGGGAGGCTGG + Intronic
911163248 1:94702523-94702545 CAGGGCCTCCTGAGGAAGGCTGG - Intergenic
911262127 1:95699242-95699264 CAGGGCCTGTTGAGGGAGGAGGG + Intergenic
911632570 1:100199742-100199764 GAGGGCCAGCAGAAGCAGGATGG + Intronic
912502326 1:110130511-110130533 CAGGAGCAGCAGGGGGAGCCAGG + Intergenic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
912962659 1:114209716-114209738 CATGGCCTGCTGAGGCAGGCTGG - Intergenic
914240261 1:145848415-145848437 CAGGGCCAGCAAAGGAAGAATGG + Exonic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
915281105 1:154822708-154822730 CAAGGGCAGGGGAGGGAGGCAGG + Intronic
915325844 1:155080799-155080821 CTGGGCCGGCAGAGGTAGGAGGG + Intronic
915597308 1:156902909-156902931 CAGGGCAGTCTGAGGGAGGCGGG + Intronic
915652901 1:157332211-157332233 CAGGGGAGGCAGAGGGAGACAGG - Intergenic
915845594 1:159260785-159260807 CAAGGCCAGCACGGGGAGGGGGG - Intergenic
915876278 1:159614690-159614712 CAAGGCCAGCAGAGAGAGTTAGG + Intergenic
916395787 1:164386023-164386045 CAGGGCCTGCAGGGGGTGGGGGG - Intergenic
916648898 1:166816813-166816835 CTGAGCCAGCAGGGGAAGGCGGG + Intergenic
916844518 1:168635699-168635721 CAGCACCAGCAGTGGGAAGCAGG + Intergenic
916890014 1:169105813-169105835 CAGGTGCAGGAGCGGGAGGCGGG + Exonic
917146266 1:171894739-171894761 CAGGGCCTGCTGGGGGAGTCGGG - Intronic
917854972 1:179092404-179092426 CAGGTCCAGCAGAATGAGGGAGG - Intronic
918177819 1:182060780-182060802 CAGGGACAGCAAAGGGATGCTGG + Intronic
919735585 1:200948243-200948265 AAAGGCCAGAAGAGGGGGGCCGG + Intergenic
919917636 1:202148581-202148603 CTGGGCCACCGGAGGGTGGCAGG + Exonic
920578896 1:207086045-207086067 GAAGGGGAGCAGAGGGAGGCAGG + Intronic
920674335 1:208028940-208028962 CTGGGCCACCACAGAGAGGCAGG + Exonic
921159711 1:212464309-212464331 GAGGGGCAGCAGTGGGAGACAGG - Intergenic
921184098 1:212655520-212655542 GATGGCCTGCAGAGGGAGGGAGG + Intergenic
921360841 1:214329840-214329862 CAGAGGCAGCTGAGGGAGGCAGG + Intronic
921944101 1:220874655-220874677 TAGGGCCAGAAGAGGGACTCAGG - Intergenic
922528575 1:226325544-226325566 TAGGGACAGCAGTTGGAGGCTGG - Intergenic
922779865 1:228243349-228243371 CAAGGGCTGCAGACGGAGGCTGG + Exonic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923226259 1:231941383-231941405 CAAGGCCAGCAAAGCGAGGTAGG + Intronic
923384377 1:233452086-233452108 CAAGGCCAGCAGACTGAGGTAGG + Intergenic
923531783 1:234817852-234817874 CAGGCTCAGCTGTGGGAGGCTGG - Intergenic
924433189 1:244015035-244015057 CAGTGACGGCAGAGGGAGCCAGG + Intergenic
924527256 1:244863673-244863695 CAGGGCCAGCAGCAGGCGGGAGG - Exonic
1062785091 10:257973-257995 CAGGGTGAGCAGAGGCTGGCTGG + Intergenic
1063053241 10:2475937-2475959 CAGGGCCAGCAGGGAGAGCCAGG - Intergenic
1063102568 10:2963257-2963279 CAGGCCCAGGAGATGGAGGGTGG - Intergenic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1065830394 10:29609350-29609372 CAGCACCAGCAGAGGGTGGGAGG - Intronic
1067560575 10:47301682-47301704 CAGGGCCTGCAAAGGTGGGCAGG - Intronic
1067753311 10:48985854-48985876 CAGAGGCAGCAGAGGTAGCCAGG + Intergenic
1067796857 10:49327145-49327167 GTGGGCCAGGAGAGGGAGGAAGG - Exonic
1067838228 10:49654670-49654692 CATGACCTCCAGAGGGAGGCAGG - Intronic
1067856601 10:49799057-49799079 CAGTGACAGAAGAGGGAGGAGGG - Intergenic
1068287772 10:54962269-54962291 CAGTGCCAGCAGAGAGCAGCAGG - Intronic
1068596169 10:58905170-58905192 TAGCCCCAGCAGAGGGTGGCAGG - Intergenic
1068987479 10:63120673-63120695 CAGGGCCAGCAGATGGGAGGAGG + Intergenic
1069628323 10:69881596-69881618 CAGGGGCAGGAGAGCCAGGCTGG + Intronic
1069712565 10:70499450-70499472 CAGAGCCCGCAGTGTGAGGCTGG + Intronic
1069782515 10:70965714-70965736 GAGGGGCAGCAGAGGCGGGCAGG - Intergenic
1069855626 10:71439484-71439506 TAGGCCCAGTAGATGGAGGCAGG - Intronic
1069879547 10:71583268-71583290 CTGAGGCCGCAGAGGGAGGCAGG + Intronic
1069963742 10:72096261-72096283 ACGGACCAGCAGAGGGAGGCGGG - Intronic
1070109334 10:73467804-73467826 CAGGGCTGGTAGAGGGAGGAAGG + Intronic
1070279399 10:75037803-75037825 CAGGGCCAGCAGAGGCACTTGGG - Intergenic
1070393862 10:75994542-75994564 CGGGAGCAGGAGAGGGAGGCTGG + Intronic
1070538022 10:77393888-77393910 CAGGACCGGCAGAAGCAGGCCGG + Intronic
1070662419 10:78316787-78316809 CAGGGCAGGCAGAGGGAACCAGG + Intergenic
1070701044 10:78601975-78601997 CAGTGCCAGGAGAGGCAGGCAGG - Intergenic
1070736959 10:78869707-78869729 CATGGCCAGCACAGGGCGGCCGG + Intergenic
1070797933 10:79227944-79227966 GAGAGCTGGCAGAGGGAGGCTGG + Intronic
1070850453 10:79558606-79558628 GAGGGACAGCACTGGGAGGCAGG - Intronic
1070856766 10:79612690-79612712 GAGGGACAGCACTGGGAGGCAGG + Intronic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1071530463 10:86387444-86387466 CAGGTCCTGCAGAGGCAGGTGGG - Intergenic
1071565076 10:86667541-86667563 CAGGGCCAGGAGGGGCAGGGAGG - Intergenic
1071598946 10:86946969-86946991 AAGGGGCTGCAGAAGGAGGCTGG + Intronic
1072563328 10:96596997-96597019 CAGGAGCAAGAGAGGGAGGCAGG + Intronic
1072627398 10:97121708-97121730 GAGGTCCTGCAGAGGAAGGCAGG - Intronic
1072687541 10:97547388-97547410 CTGGGGCAGAAGAGGGAGGATGG - Intronic
1072711045 10:97715613-97715635 CCGGGACAGCACAGGGATGCTGG - Exonic
1072712381 10:97724414-97724436 CAGGGCCACGAGAGGGAGGAGGG - Intergenic
1072898580 10:99388056-99388078 AAGGGCTAGAAGAGGAAGGCAGG - Intronic
1073073815 10:100810854-100810876 CAGGGCCATGGGGGGGAGGCGGG - Intronic
1073100095 10:101001994-101002016 GAGGCCCAGCAGAGGGAGGCAGG + Exonic
1073122890 10:101132897-101132919 CAGGGCCAGCAGAGGAAGGCGGG - Intronic
1073336440 10:102714066-102714088 CTGGGCCTGGAGAGGAAGGCGGG - Intronic
1073778226 10:106809441-106809463 CAGGGCTAGCAGGGGGATCCTGG - Intronic
1074001539 10:109378698-109378720 CAGGGCCAGTGCAGGGAGGAGGG + Intergenic
1074690767 10:116002158-116002180 CAGGGCCGGCAGGGGGATGGTGG + Intergenic
1074818570 10:117163098-117163120 CCCGGCCAGCAGACGGAGGCTGG - Intergenic
1074824090 10:117202150-117202172 CAGGGGTTGCAGAGAGAGGCTGG + Intronic
1074881946 10:117666479-117666501 CAGGGACAGCAGAGGGTGTGTGG + Intergenic
1075400726 10:122159667-122159689 GGTGGCGAGCAGAGGGAGGCTGG - Intronic
1075664438 10:124220693-124220715 CAGGGCTGGCAGAGGGCGGAAGG - Intergenic
1075734354 10:124654834-124654856 CAGGGCGAGCAGAGGCACGCCGG - Intronic
1075979153 10:126722289-126722311 CAGGGCCAGCTGGGGGATGGAGG + Intergenic
1076035581 10:127196425-127196447 CAGGGCCAGGAGGCGGGGGCGGG + Intronic
1076209323 10:128627773-128627795 CAGGGTCAGCAGGGGCACGCTGG + Intergenic
1076221284 10:128734956-128734978 CAGGGTCAGAAGAGGGAGCACGG + Intergenic
1076534312 10:131167153-131167175 CAGGCACAGGAGAGGGATGCCGG - Intronic
1076537185 10:131187190-131187212 CAGTGCCAGCAGAGGCACGTCGG + Intronic
1076620071 10:131781341-131781363 CAGGCACAACAGAGGGATGCAGG + Intergenic
1076684287 10:132190094-132190116 CAGGGCCATGAGAGAGGGGCTGG - Intronic
1076704920 10:132296049-132296071 CAGGGCCAGCATCGGCAGGAAGG + Intronic
1076824744 10:132961184-132961206 CAGGGCCTGCAGCCTGAGGCTGG - Intergenic
1077132097 11:978168-978190 CAGGGCCTGGTCAGGGAGGCAGG + Intronic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077244530 11:1529778-1529800 CAGGGCCTCCTGAAGGAGGCAGG + Intergenic
1077288735 11:1779154-1779176 CAGAGCCAACAGAGAGAGGCAGG - Intergenic
1077336433 11:2007001-2007023 CAGGGCCAGCAGGCTGAGCCAGG - Intergenic
1077387222 11:2275748-2275770 CAGGCCCAGCAAAGAGGGGCAGG + Intergenic
1077393938 11:2312052-2312074 CAGGGCAGGCAGAGCCAGGCAGG + Intronic
1077425492 11:2474039-2474061 CTGGGCCAGCGGTAGGAGGCTGG - Intronic
1077631982 11:3817153-3817175 CAGGAGCAGCAGAGACAGGCAGG - Intronic
1078002945 11:7512735-7512757 CACAGCCAGCAGGGGAAGGCTGG - Intergenic
1078240774 11:9529413-9529435 CAGGACCAGCACTGGGAGGCTGG - Intergenic
1079058891 11:17230264-17230286 TAGCTCCAGCAGAGGGAGCCAGG + Intronic
1079107018 11:17578291-17578313 CAGGGGCAGCAGCTGGAGGATGG - Intronic
1079611033 11:22432746-22432768 CAGGGTCTGCGGCGGGAGGCGGG + Intergenic
1079724827 11:23867780-23867802 TAGGGCCAGCAGACTGAGGTGGG - Intergenic
1080617269 11:33955571-33955593 AAGAGCCAGCTGATGGAGGCAGG - Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083270421 11:61569500-61569522 CTGGGGCAGCAGAGGGAGCCAGG + Intronic
1083319917 11:61839184-61839206 GAGGGCGAGCTGAGGCAGGCAGG - Intronic
1083324743 11:61867494-61867516 CAGAGGCAGCAGGGAGAGGCGGG - Intergenic
1083739051 11:64698117-64698139 CAGGGCCAGGAGTGGCAGTCAGG + Intronic
1083765246 11:64838482-64838504 CTGGGCCAGCGGATGGTGGCTGG + Intronic
1083857733 11:65401382-65401404 GAGGGGCAGGGGAGGGAGGCTGG - Intronic
1083864596 11:65446619-65446641 CAGGGCCAGGGAAGGGAGCCAGG + Intergenic
1083955872 11:65982479-65982501 CAGGACCAGCTGGGGAAGGCAGG - Intergenic
1083990423 11:66243067-66243089 AAGGGACTGGAGAGGGAGGCAGG + Intronic
1084184389 11:67464078-67464100 CAGGGCCACCAGACAGAGACGGG + Exonic
1084315437 11:68342913-68342935 CCAGCCCAGCCGAGGGAGGCAGG - Intronic
1084357886 11:68651721-68651743 CAGGGACCGCAGAGGGAGGGAGG + Intergenic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1085039567 11:73318916-73318938 CAGGGCCGCCAGAGGCGGGCAGG - Intronic
1085186392 11:74579411-74579433 CAGGGACAGCAGAGGGGTGGTGG + Intronic
1085282863 11:75342243-75342265 CAGGGCTCGGAGAGGGAAGCAGG - Intronic
1085331848 11:75658695-75658717 AAGGGACAGAAGAGGGAGGTAGG - Intronic
1085396701 11:76210163-76210185 CGGGGGCAGAAGAGGGGGGCCGG + Intronic
1086027286 11:82309162-82309184 CAAGGTCAGGGGAGGGAGGCAGG - Intergenic
1086370671 11:86152498-86152520 CAGGACTAGGGGAGGGAGGCAGG + Intergenic
1086517443 11:87629141-87629163 AAAGCCCAGCAGATGGAGGCAGG + Intergenic
1086972666 11:93100379-93100401 CAGGGCCTGCATGGGGAGGGTGG - Intergenic
1087129937 11:94660026-94660048 CAGGGTCAGGGGAGGGAGTCGGG - Intergenic
1087625871 11:100595401-100595423 CAGGCCCAGCAGAGCTAGGAAGG - Intergenic
1088077098 11:105863613-105863635 CAGGGGCAGGAGTGGGAGGGAGG - Intronic
1088550775 11:111010324-111010346 CAGGGCCACGAGAGGGAGGCTGG + Intergenic
1088693436 11:112346662-112346684 CATGGCCTGGTGAGGGAGGCAGG - Intergenic
1089111736 11:116062704-116062726 CAGCTCACGCAGAGGGAGGCAGG + Intergenic
1089508449 11:118980275-118980297 CTGGGCCCTCAGAGGGAGGGAGG + Intronic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1090067882 11:123519046-123519068 GAGGGCTAGCAAAGGGTGGCAGG - Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090399928 11:126442693-126442715 CAGAGCAGGCAGAGGGAGGGGGG - Intronic
1091297702 11:134485534-134485556 CAGGGGCAGCAGAAGGATGTGGG + Intergenic
1202819417 11_KI270721v1_random:62183-62205 CAGGGCCAGCAGGCTGAGCCAGG - Intergenic
1091379416 12:46318-46340 CAGTGCCAGAAGAGGAAGTCAGG - Intergenic
1091534362 12:1391591-1391613 CAGGGAAAGCCGAGGGAGGCAGG - Intronic
1091568624 12:1665129-1665151 CAGGGCTGGCACAGGGAAGCTGG - Intergenic
1091596281 12:1881120-1881142 CAGGGACAGGAGAGGGAAGGAGG + Intronic
1091653395 12:2326038-2326060 TGGGGGCAGCAGGGGGAGGCAGG + Intronic
1091673217 12:2467579-2467601 CAGAGACAGCAGGGGGTGGCGGG + Intronic
1091912429 12:4243116-4243138 CAGGCCCAGCACAGGCTGGCAGG + Intergenic
1092218471 12:6698016-6698038 TTGGCCCAGCAGAGGGAGCCTGG - Intronic
1092275886 12:7060728-7060750 CAGAACCAGGACAGGGAGGCTGG + Intronic
1092431783 12:8415653-8415675 CAGGGACAGCAAAGTGAGGACGG + Intergenic
1092434734 12:8438273-8438295 CAGGGACAGCAAAGTGAGGACGG + Intergenic
1093016546 12:14161149-14161171 GAGGGTCAGGAGAGGGAGGGGGG + Intergenic
1094048664 12:26195694-26195716 CGCGGCCAGCAGAGGCAGGGGGG + Exonic
1094486109 12:30926923-30926945 CCGGGCGGGCAGAGGGAAGCCGG + Intronic
1094710451 12:32956711-32956733 CAGAGCCTACAGAGGCAGGCAGG - Intergenic
1094844975 12:34357527-34357549 CAGGGCCAGCCCAAGGCGGCAGG - Intergenic
1094847145 12:34366319-34366341 CAGGGCCAGCCCAAGGCGGCGGG - Intergenic
1094851657 12:34385009-34385031 AGGGGCCAGCACAAGGAGGCAGG - Intergenic
1095821196 12:46480347-46480369 CAGGCCCAGCAAATGGAAGCTGG - Intergenic
1095964626 12:47858566-47858588 CTGCCCCAGCACAGGGAGGCAGG - Intronic
1096604939 12:52757933-52757955 GAGGGGCAGGAGAGGGAGGAGGG - Intergenic
1096863814 12:54549533-54549555 GAGGGAGAGCAGAGGGAGGGGGG + Exonic
1096975793 12:55698671-55698693 CCGTGCCACCTGAGGGAGGCTGG - Intronic
1097173940 12:57132138-57132160 CTGGGACAGAAGAGGGAGGCAGG - Intronic
1097202883 12:57294655-57294677 GAGGCCAAGCAGAGGCAGGCTGG + Intronic
1097221885 12:57455900-57455922 CAGGAGCAGCAGAGGGAGTGGGG + Intronic
1097728461 12:63100791-63100813 CAGGGCCAGCAGATTGAGTTGGG + Intergenic
1097794148 12:63844373-63844395 CAGGGCCAGCGGCGGAGGGCAGG - Exonic
1098389710 12:69956605-69956627 CTGGGCAAGCAGAGGGAGAGAGG - Intronic
1099222929 12:79935299-79935321 CTGGGCCACCAGAGGGAAGCGGG + Intronic
1101395715 12:104345324-104345346 CAGAGCCAGCTGTGGTAGGCTGG + Intronic
1102287001 12:111665761-111665783 CAGGTCCATCACTGGGAGGCTGG + Exonic
1103043975 12:117719960-117719982 AAGGGCCAGGAGTGGGATGCTGG - Intronic
1103173416 12:118841906-118841928 CCAGGCCAGCAGAGGGATGCTGG + Intergenic
1104062489 12:125280548-125280570 TAGGTCCAGGGGAGGGAGGCAGG - Intronic
1104092136 12:125526143-125526165 GAGGCCCAGAGGAGGGAGGCTGG - Intronic
1104569102 12:129909459-129909481 CAGGCCCAGCCCAGGGAGGCCGG + Intergenic
1104603458 12:130169461-130169483 CAGGGACAGAGGAGGGAGGAGGG + Intergenic
1104800585 12:131552899-131552921 CAGTGCAATCAGAGTGAGGCTGG + Intergenic
1104861222 12:131925127-131925149 CGGGGCCAGCAGAGCTAGGCTGG - Intergenic
1104871526 12:132001707-132001729 CAGGGCCACCAGAGGGCTCCTGG - Intronic
1104878289 12:132051939-132051961 CAGGGCCACCAGAGGGCTCCTGG - Intronic
1104896883 12:132169028-132169050 CAGGGCCAGCCGGGAGGGGCAGG - Intergenic
1104917882 12:132275354-132275376 CAGAGCCAGGAGAGGTTGGCTGG + Intronic
1104966374 12:132510331-132510353 CAGGGCCAGGAGCGAGAGCCGGG - Intronic
1104980108 12:132569909-132569931 CTGGGCCTGCAGAGAGAGGGTGG - Exonic
1105020132 12:132810640-132810662 CAGGGCCACCAGAGGGCTCCTGG + Intronic
1105043055 12:132977062-132977084 CAGGGCCACCAGAGGGCTCCTGG + Intergenic
1105270975 13:18875250-18875272 CGGGGCCAACAGCGGGCGGCGGG - Intergenic
1105418308 13:20232018-20232040 CAGAGCCGGCAGAGCGCGGCCGG - Intronic
1105701776 13:22939978-22940000 CAGGGTCCCCAGAGGAAGGCGGG + Intergenic
1105865054 13:24451691-24451713 CAGGGGCCACAGAGGCAGGCAGG + Intronic
1105897000 13:24725068-24725090 CAGGGCTGGCAGAGCGTGGCAGG - Intergenic
1106286742 13:28324505-28324527 CCGGGGTTGCAGAGGGAGGCAGG + Intronic
1109328575 13:60900180-60900202 GAGGGCGAGCAGAGGAAGGGTGG + Intergenic
1110084783 13:71364388-71364410 CAGAGCCATCAGAGAGAGCCTGG - Intergenic
1110604752 13:77418975-77418997 TAGGGCCAGCAGAGGGCTGTGGG - Intergenic
1111769230 13:92575468-92575490 CAGAGCCTGCAGAGGGAACCTGG + Intronic
1112899951 13:104345959-104345981 TAGGGCCTACAGAGGCAGGCAGG + Intergenic
1113728316 13:112622358-112622380 CAGGGACAGCTAGGGGAGGCAGG - Intergenic
1113728854 13:112625400-112625422 CGGGGGCAGGAGAGGGAGACTGG - Intergenic
1113912290 13:113848584-113848606 CTTGGCCAGCAGAGGCCGGCCGG + Intronic
1113931019 13:113968943-113968965 ATGGGCCAGCAGAGGGAGCCAGG - Intergenic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1114532248 14:23403309-23403331 CAGGGACAGCAGTGGGTGGGGGG + Intronic
1115430315 14:33309898-33309920 CTGGCCCTGCAGAGGGAGGAGGG + Intronic
1116618722 14:47172183-47172205 CGGGGCCTACAGAGGCAGGCAGG - Intronic
1117675638 14:58152284-58152306 CAGTGCCAGCAGAGCCAGGGCGG - Intronic
1118737362 14:68711621-68711643 CAGGGCAAGCAGATGGGGGAAGG - Intronic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1118865035 14:69696128-69696150 CGGGGCCTGCTGAGGGGGGCAGG - Intronic
1119619082 14:76118209-76118231 TGGGGCCAGCAAAGGGATGCAGG + Intergenic
1119719694 14:76882706-76882728 CAGGGGAAGCAGAAGCAGGCAGG - Intergenic
1119767686 14:77200628-77200650 CAGGGGCAGCAGAGCCAGGATGG - Intronic
1119806047 14:77483012-77483034 CAGGTCCAGCAGATGCATGCTGG - Intronic
1120145969 14:80978663-80978685 CAGGTGCTGCAGATGGAGGCTGG + Intronic
1121532918 14:94671148-94671170 AAGGTCCAGCAGAGGGAGACAGG + Intergenic
1121775956 14:96591026-96591048 CAGGGCCTGCAGGGCCAGGCAGG - Intergenic
1121943784 14:98098888-98098910 CTGGGGCAGCAGAGGGAGAGGGG + Intergenic
1122243099 14:100382176-100382198 CAGGGCTTGCACAGTGAGGCGGG + Intronic
1122279180 14:100611061-100611083 GAGGGCTGGGAGAGGGAGGCTGG - Intergenic
1122295054 14:100700812-100700834 CATAGCAAGTAGAGGGAGGCTGG + Intergenic
1122348281 14:101073636-101073658 CTGGGGCTGCAGAGGGAGGCCGG - Intergenic
1122406528 14:101504295-101504317 AAGGGCCAGCTGGGAGAGGCAGG + Intergenic
1122409655 14:101519302-101519324 CAGGGCCAGCAGCCCGTGGCTGG + Intergenic
1122461839 14:101902470-101902492 CACGTCCAACAGAGGCAGGCAGG - Intronic
1122779787 14:104138775-104138797 CCCGGCCTGGAGAGGGAGGCGGG + Intronic
1122892050 14:104736569-104736591 CAGGCTCAGCTGAGGGAGACGGG - Intronic
1122893264 14:104742729-104742751 CATGGGCAGCTGGGGGAGGCGGG - Intronic
1122977917 14:105178530-105178552 CTGGGCCTGCTGGGGGAGGCTGG + Intronic
1123176197 14:106421607-106421629 CAGGGCCAGCAGGGGGCGTGCGG - Intergenic
1124129967 15:26974571-26974593 CAGAGACAGCAGAGGGAGGGAGG + Intronic
1124804439 15:32867336-32867358 CAGGGAGAGCAGGGTGAGGCTGG - Intronic
1125929510 15:43590171-43590193 CTGCGCGAGCGGAGGGAGGCGGG - Exonic
1125942677 15:43690003-43690025 CTGCGCGAGCGGAGGGAGGCGGG - Intergenic
1126163575 15:45635139-45635161 CTGGGCCAGCGGAGGGAGACTGG + Intronic
1126851849 15:52801871-52801893 TAGAGTCTGCAGAGGGAGGCGGG - Intergenic
1126990895 15:54374392-54374414 GAGGGGCATGAGAGGGAGGCCGG - Intronic
1127287527 15:57544517-57544539 CAGGTCCAGCAAAGAGGGGCTGG + Exonic
1127775975 15:62264559-62264581 CAGGGCCTGGACAGGGAAGCTGG + Intergenic
1128358242 15:66943330-66943352 CAGGGCCAGCTCTGGGGGGCAGG + Intergenic
1128635320 15:69298995-69299017 CGGGGACAGCACAGGCAGGCCGG - Exonic
1128676652 15:69614860-69614882 GAGGGCCAGCACAGTGGGGCTGG - Intergenic
1128720447 15:69943763-69943785 GAGGGCCAGGGGAAGGAGGCTGG + Intergenic
1129166415 15:73780738-73780760 GAGAGCCAGCAGAGGCAGGGGGG + Intergenic
1129676252 15:77633602-77633624 CCTGTCCAGCAGAGGGCGGCAGG + Intronic
1129699316 15:77758518-77758540 CAGAGCCAGCAGGGGCAGTCAGG + Intronic
1130064639 15:80593771-80593793 CAGGGCAAGCAGGGCGAGGGTGG - Exonic
1130109185 15:80950603-80950625 GAGGCCCAGCAGAGGGAGTAGGG + Exonic
1130403459 15:83578272-83578294 CAGGGGCTCCGGAGGGAGGCAGG - Intronic
1130962791 15:88674681-88674703 CAGAGCCTGCAGAGGGGGGCTGG - Intergenic
1131135702 15:89933518-89933540 CAGGGGCAGGAGTGGGAGGGAGG + Intergenic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131430076 15:92380253-92380275 CAGACCCACCAGAAGGAGGCTGG - Intergenic
1131510098 15:93045016-93045038 CAGGGCCAGGAGCGGGACGAGGG + Exonic
1132110159 15:99096966-99096988 CAGGCCTAGCAGAGGGCGGATGG + Intergenic
1132186684 15:99806952-99806974 CGGGGCCAGCTGAGGGAGGAAGG - Intergenic
1132240623 15:100254832-100254854 CAGGGCCAGCCGGGGGAGGCGGG + Intronic
1132244012 15:100280565-100280587 CAGGGCCTGGTGAGGGAGGGCGG - Intronic
1132429003 15:101745759-101745781 CGGGGCCAGCTGAGGGAGGAAGG + Intergenic
1132515133 16:362708-362730 CAAGGCCATCAGAGGGACCCGGG + Intergenic
1132558786 16:584232-584254 CAGGGCCTCCAGCAGGAGGCCGG - Intergenic
1132606354 16:795397-795419 CACGGGCAGCACAGGGGGGCGGG - Intronic
1132606429 16:795581-795603 CACGGGCAGCACAGGGGGGCGGG - Intronic
1132674693 16:1116892-1116914 CCGGGGGAGCAGAGGGGGGCGGG - Intergenic
1132717844 16:1301063-1301085 CAGGGCCAGCAGGGGGCGGCAGG + Intergenic
1132833478 16:1941171-1941193 TGGGGCAAGCAGAGGGAGGAAGG + Intronic
1132869160 16:2108022-2108044 CTCGGCCTGCAGAGGGAGGCTGG - Exonic
1132908562 16:2296965-2296987 CAGGGCCAGCAGGGGCTGACAGG - Intronic
1133280002 16:4659881-4659903 CAGGGCCAGCTGAGGGAGATGGG - Intronic
1133343657 16:5055542-5055564 CAAGGCCCTCAGTGGGAGGCGGG - Intronic
1133771621 16:8869799-8869821 TAGGGGCTGCAGAGTGAGGCAGG - Intergenic
1133998193 16:10763131-10763153 CAGGGGTGGTAGAGGGAGGCCGG + Intronic
1134213082 16:12294521-12294543 GACAGACAGCAGAGGGAGGCGGG - Intronic
1134550212 16:15135419-15135441 CTCGGCCTGCAGAGGGAGGCTGG - Intronic
1134625649 16:15720802-15720824 GGAGGCCAGCAGAGGGAGGTCGG - Intronic
1134718257 16:16367576-16367598 CTCGGCCTGCAGAGGGAGGCTGG + Intergenic
1134956495 16:18384583-18384605 CTCGGCCTGCAGAGGGAGGCTGG - Intergenic
1135083893 16:19459244-19459266 CAGGGCCATGTGAGGGAGGCAGG + Intronic
1135328306 16:21541899-21541921 CAGGGCCCCCAGAGGAAGTCAGG + Intergenic
1135688183 16:24515066-24515088 CAGGGGCAGCTTAGGAAGGCTGG + Intergenic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1135996458 16:27253048-27253070 CAGGGCCAGCTGTGGGAAGTGGG - Intronic
1136012447 16:27372588-27372610 AAAGGCCAGCAGAGGGAGGCAGG - Intergenic
1136185683 16:28587555-28587577 CAGGGCCAGAAGATGGAGGTAGG - Intronic
1136265104 16:29111580-29111602 CAGCACCAGCAGAGCGGGGCAGG + Intergenic
1136267457 16:29130030-29130052 CTGTGCCAGCACAGGAAGGCAGG - Intergenic
1136347694 16:29686800-29686822 CAAGGCCAGGAGTTGGAGGCTGG - Intronic
1136381475 16:29898066-29898088 CAGGCCCAGCTGATGGAGGAGGG - Intronic
1136402318 16:30025330-30025352 CACGGCCAGCAGGGGCAGGCCGG + Exonic
1136513115 16:30751317-30751339 CAGGGCCAGCAGGAGGTGGGGGG - Intronic
1136537309 16:30907598-30907620 CAGGGTCAGCAGGCAGAGGCGGG + Intergenic
1138206684 16:55130639-55130661 CAGGGCCTGCAGAGGAGAGCAGG - Intergenic
1138510867 16:57507811-57507833 CTGGGCCAGCGGAGCGGGGCTGG - Intergenic
1138598508 16:58041878-58041900 CAGGGCCAGGCATGGGAGGCGGG - Intronic
1138659272 16:58508104-58508126 CAGGGCCAGCAGTGGACGGTGGG + Intronic
1139329380 16:66175695-66175717 CTGGGGGAGAAGAGGGAGGCCGG + Intergenic
1139475236 16:67199610-67199632 CAGGGCCTGCGGAGGGCGGGAGG + Intronic
1139476045 16:67203044-67203066 GAGGGCAGGCAGAGGGCGGCTGG + Intronic
1139599511 16:67978154-67978176 AGGGGTCCGCAGAGGGAGGCTGG - Intronic
1139647600 16:68342795-68342817 CACAGCCTGCAGAGGGATGCTGG - Intronic
1139655033 16:68382367-68382389 CAGGGCTGGCAGGGGCAGGCTGG + Intronic
1140225069 16:73070609-73070631 CAGTGCCTGCCGAGGGAGGGCGG - Intergenic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1141934776 16:87229953-87229975 AAGGGCAAGGACAGGGAGGCAGG - Intronic
1141949832 16:87333331-87333353 CCGGCACAGCAGAGGCAGGCAGG + Intronic
1141980951 16:87550390-87550412 CAGGGGCCGAAGAGGGAGTCAGG - Intergenic
1142053901 16:87979555-87979577 CAGCACCAGCAGAGCGGGGCAGG + Intronic
1142070748 16:88090353-88090375 CTGTGCCAGCACAGGAAGGCAGG - Intronic
1142135363 16:88449511-88449533 CAGGGGCAGAAGCTGGAGGCCGG - Intergenic
1142228691 16:88889357-88889379 CTGGGGCAGCGGAGGGAGGGAGG + Intronic
1142277981 16:89132917-89132939 CAGGGCCCACAGAGGACGGCGGG + Intronic
1142363331 16:89637407-89637429 GAGGGCCTGCCCAGGGAGGCGGG - Intronic
1142414225 16:89932693-89932715 CAGGGCTGGGATAGGGAGGCTGG - Intronic
1142558897 17:798366-798388 CAGGCCCTGCAGGTGGAGGCTGG - Intergenic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142597653 17:1037331-1037353 GAGGTCAGGCAGAGGGAGGCTGG - Intronic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1143018792 17:3905513-3905535 CCAGGCCAGCAGCGGGAGGCAGG - Intronic
1143100419 17:4501528-4501550 CCAGGCCAGGAGAGGGAGGGAGG - Intronic
1143296449 17:5875170-5875192 CAGGGGCACCAGCTGGAGGCAGG + Intronic
1143387929 17:6543183-6543205 CGGGGCCAGGAGAGGGAGTGGGG - Intronic
1143390086 17:6555280-6555302 CAGTGCCTGCACAGGGAGACGGG + Intronic
1144457622 17:15432075-15432097 CTGGACCAGCAGAGGTAGGATGG - Intergenic
1144586691 17:16491770-16491792 CAGGGCCGGCGGGAGGAGGCGGG - Exonic
1144634249 17:16893972-16893994 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1144708515 17:17385459-17385481 CAGGGGCTGCAGAGGGGGGATGG - Intergenic
1144807516 17:17977671-17977693 CAGGGCCCCCAGGAGGAGGCCGG + Exonic
1145168363 17:20633867-20633889 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1145230270 17:21168820-21168842 CAGGGCCAGGAGACCAAGGCTGG + Intronic
1146059108 17:29595293-29595315 AAGAGCCAGCAGAGGCTGGCTGG - Intronic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1147122368 17:38343298-38343320 CAGGGCCAGCTGTAGGTGGCTGG + Exonic
1147122573 17:38344175-38344197 AAGGGCAGGCAGAGGGAGGGAGG - Intergenic
1147235861 17:39057045-39057067 CAGGCTCAGCGAAGGGAGGCTGG + Intergenic
1147340425 17:39750456-39750478 CAGGTCCAGCAGACAGAGGTGGG + Intergenic
1147353244 17:39868462-39868484 CAGGGCGAGGCGAAGGAGGCAGG - Intronic
1147732871 17:42614714-42614736 CAGGGCCAGCAGATGCAGAGAGG - Intronic
1148052912 17:44777917-44777939 CAGGGCCAGGAGAGGTGAGCAGG - Intronic
1148107109 17:45124571-45124593 CAGGGCCAACAGAGGTAAGGAGG + Intronic
1148127193 17:45242942-45242964 CAGGGGAAGCACAGGGAGCCTGG - Intronic
1148147763 17:45376786-45376808 CAGGGCCAGGAGTGAGAGGTGGG - Intergenic
1148208089 17:45792120-45792142 CACGGGCAGCTGAGGGATGCCGG - Intronic
1148546382 17:48522319-48522341 CAGAGCCAACAGGAGGAGGCTGG + Intergenic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1149648103 17:58255007-58255029 CAGAGCCAGGAGTGGGAGCCAGG - Intronic
1149648185 17:58255607-58255629 CAGAGCCAGGAGTGGGAGCCAGG + Intronic
1149684657 17:58528426-58528448 TAGAACCAGCAGATGGAGGCTGG + Intronic
1150281549 17:63932058-63932080 CAGGGCCATGAGAGGGAGACAGG + Intronic
1151318378 17:73337792-73337814 CAATTCCAGCACAGGGAGGCAGG + Exonic
1151379785 17:73717738-73717760 CAGGCCCAGCGCTGGGAGGCTGG - Intergenic
1151380748 17:73724214-73724236 CAGTGCTAGGAGAGGGAGGCTGG + Intergenic
1151560330 17:74866392-74866414 CAGGGGCTGCAGAAGGAGGCCGG - Intronic
1151960229 17:77401966-77401988 AAGGAGCAGCAGAGGAAGGCAGG - Intronic
1152259546 17:79259674-79259696 CAGGCTCAGCAAAGGGAGCCCGG - Intronic
1152302965 17:79506216-79506238 CAGAGCCAGAAAAGGGAGGAGGG + Intronic
1152497320 17:80682630-80682652 CAGGGCCTCCAGAGGGAGCGTGG + Intronic
1152589465 17:81204288-81204310 CAGGGCCAGCTGGGGAGGGCAGG - Intronic
1152769439 17:82158132-82158154 CAGGGCCAGCTGGGCGGGGCAGG - Intronic
1152925646 17:83086510-83086532 CAGGGCCCCCAGAGCAAGGCTGG - Intronic
1152945692 17:83196302-83196324 CAGAGCCACCAAAGGCAGGCAGG - Intergenic
1153025550 18:669242-669264 CAGAGGCACCTGAGGGAGGCAGG + Intronic
1153185479 18:2481477-2481499 CAGGGCCGGGAGTGGGAAGCTGG + Intergenic
1153242721 18:3045214-3045236 CAAGGCCAGCTGAGGGTGGAAGG + Intergenic
1153577706 18:6539335-6539357 CAGAGCCAGGAGAGAGAGGAGGG + Intronic
1153752535 18:8247976-8247998 CAGGGATAGCAGAGAGAGGGCGG - Intronic
1155680852 18:28483698-28483720 CAGGGAAAGAAGTGGGAGGCAGG + Intergenic
1156093818 18:33505101-33505123 CAGGTCAAGCAGTGGGGGGCGGG - Intergenic
1156196609 18:34781120-34781142 CAGGGGCAGGAGAAAGAGGCAGG + Intronic
1156409581 18:36815056-36815078 CAGGTACACCAGATGGAGGCTGG + Intronic
1156654765 18:39272137-39272159 TAGTGACAGCAAAGGGAGGCAGG - Intergenic
1157407902 18:47438816-47438838 CAGGAGCAGGAGAGTGAGGCAGG - Intergenic
1157489073 18:48109690-48109712 CAGGGCCTGCAGAGGAGGGAGGG + Intronic
1157779813 18:50428237-50428259 CAGAGCAAGCAAAGGGAGGGAGG + Intergenic
1157818489 18:50748504-50748526 GAGCCCCAGGAGAGGGAGGCAGG - Intergenic
1157862522 18:51153856-51153878 CAGGGCTGGCCGAGGGGGGCTGG + Intergenic
1158962975 18:62601666-62601688 CAGGGCGAGGAGAGGGCAGCTGG + Intergenic
1160150066 18:76391885-76391907 CAGAGCCAGCAGGAGGAGGCCGG + Intronic
1160209734 18:76866814-76866836 CAGGGCGCGCAGGGGGAGGGAGG + Intronic
1160239775 18:77114853-77114875 CAGGGCGAGCAGTGGGCTGCAGG + Intronic
1160399942 18:78602734-78602756 CAGGGCGTGCACAGAGAGGCAGG + Intergenic
1160527437 18:79545867-79545889 TAGTGACAGCAAAGGGAGGCAGG + Intergenic
1160527965 18:79548281-79548303 CAGGGCCAGCAGGTGGAAGGCGG - Intergenic
1160557903 18:79738017-79738039 CAGGGCGGGCGGGGGGAGGCGGG - Intronic
1160710650 19:549550-549572 CAGGGCCCGCCGAGGGGAGCAGG - Intronic
1160782791 19:885226-885248 CAGGGACAGCAAAGGGACACAGG + Intronic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1161065653 19:2236107-2236129 CAGTGCCAGGGGCGGGAGGCCGG - Intronic
1161094420 19:2381313-2381335 CAGGGTCAGCAGAGGCAGCTGGG + Intergenic
1161458408 19:4381556-4381578 CAGGGGGAACAGAGAGAGGCAGG - Intronic
1161498357 19:4599231-4599253 GAGGGCCTGCAGAGGAAGGAAGG - Intergenic
1161502294 19:4623003-4623025 CACGGGCAGCAGAGGGAGCGAGG - Intergenic
1161513083 19:4682596-4682618 CAGGGCCAGCTGGGGCAGGAGGG + Intronic
1161570902 19:5030452-5030474 CAGAGCCTGCAGAGGGGGGTGGG + Intronic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1162099556 19:8331628-8331650 CAGGGCAAGCAGCTGGAGGTGGG + Intronic
1162289536 19:9768560-9768582 CCGGAGCAGCAGCGGGAGGCCGG + Exonic
1162743435 19:12786225-12786247 CAGGGACACGGGAGGGAGGCTGG + Intronic
1163112596 19:15170507-15170529 CAGTGGCAGCAGCGGGACGCTGG + Exonic
1163648607 19:18504181-18504203 CAGGGACGGCACAGAGAGGCTGG + Intronic
1163681249 19:18683856-18683878 CAGGGCCGGCGGAGGGAGGGAGG + Intronic
1163701673 19:18789537-18789559 CATCCCCAGCAGAGGGGGGCAGG + Intronic
1164080547 19:21858390-21858412 CAGAGCCAGCAAAGGGAGATAGG - Intergenic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1164798401 19:31055071-31055093 CAGGGCAAGCAGGGAGAGGGAGG + Intergenic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165308337 19:35015760-35015782 CGTGGCCCGCAGAGGGAGGGAGG + Intronic
1165347164 19:35255747-35255769 CAGGGACAGCAGAGAGTGCCAGG - Intronic
1165792937 19:38502822-38502844 CAGGGGCAGCAGAGCGGGCCTGG + Intronic
1165900548 19:39167438-39167460 CAGGGCCACCAGGGGTGGGCTGG + Intronic
1166077558 19:40422648-40422670 CAGGGCTGGCAGGGGGAGCCTGG - Exonic
1166287943 19:41844015-41844037 GAGGACCAGCAGAGAGAGGGAGG + Exonic
1166302753 19:41921689-41921711 CAGAGGCAGGAGAGGGATGCAGG + Intronic
1166334884 19:42099715-42099737 CAGGCCCAGCAGAGCCAGCCAGG - Exonic
1166831826 19:45643823-45643845 CTGGACCTGCAGAGGGAGGTGGG + Intronic
1166894750 19:46016403-46016425 CAGGGGCAGGTGAGGGAGGAAGG - Intronic
1167156317 19:47741434-47741456 CAGGGCCATGGGAGGGGGGCCGG - Exonic
1167169802 19:47823545-47823567 CAGAGGCTGCAGAGAGAGGCTGG + Intronic
1167238681 19:48330475-48330497 CGGGGGCAGCCGAGCGAGGCGGG - Exonic
1167435028 19:49474345-49474367 CAGGGGGAGCAGAGGGTGGGGGG + Intronic
1167595885 19:50427931-50427953 CAGATCCAGGAGATGGAGGCCGG + Intronic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
1168695297 19:58400812-58400834 CAGGGCCCCCTGAGGGTGGCGGG - Intergenic
925079660 2:1053972-1053994 CAGGGCCTGCAGAGGGAGGAGGG - Intronic
925887312 2:8404023-8404045 CAGGGCCAGCAGGGAGGGACTGG - Intergenic
926145681 2:10395996-10396018 CAGGCAGAGAAGAGGGAGGCGGG + Intronic
926166162 2:10523082-10523104 CAGGGGCAGCAGAGGGCAGTGGG + Intergenic
926202618 2:10812649-10812671 GCGGGCCAGCGGAGGGAGGCGGG - Intronic
926924451 2:17972985-17973007 AAGGGGCTGGAGAGGGAGGCAGG + Intronic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
927886483 2:26721637-26721659 GAGGGCCCTCAGAGGAAGGCTGG - Intronic
928316815 2:30252813-30252835 CAGGGCTGGCAGAGGGAGGAAGG + Intronic
928317021 2:30254626-30254648 CAGGCCCAGCAAAAGGAGGAGGG - Intronic
928497754 2:31851709-31851731 CGGGGCCGGCGGAGGGAGGAAGG - Intergenic
929030687 2:37647791-37647813 CACAGCCAGCAAAGGGAGTCAGG - Intronic
929989945 2:46778438-46778460 GGGGGGCAGCAGAGGGAGGTGGG + Intergenic
930712210 2:54559627-54559649 CAGGGACAGCTGAGGGGTGCAGG - Intronic
932192264 2:69750952-69750974 CATCTCCAGCAGAGAGAGGCAGG - Intronic
932321357 2:70824097-70824119 CAGAGCCAGGAGAGGGAGAGAGG + Intergenic
932331397 2:70900351-70900373 CAAGCCCGGCAGAGGGAGACTGG - Intergenic
932413346 2:71559955-71559977 CTGGCCCCGCAGAGGCAGGCAGG + Intronic
932432790 2:71685700-71685722 CAGGGCCAGCGTGGGGAGGCAGG + Intronic
932494649 2:72140348-72140370 CAGGGGCTGCTGAGGGGGGCGGG - Intronic
932597739 2:73104663-73104685 CTGGGCCAGGAGAGGGAGTGAGG - Intronic
932765269 2:74465197-74465219 CAGTGCCGGCAGAGGGAGTGCGG - Exonic
933698603 2:85238285-85238307 CAGGGCAGGCAGCGGGAGGCGGG + Intronic
934116943 2:88807616-88807638 CTGGGACAGATGAGGGAGGCAGG - Intergenic
934590585 2:95546660-95546682 CAGGGACAGCCCAGGGAGGACGG - Intergenic
934949929 2:98569357-98569379 CAGCGCCTGCACAGAGAGGCCGG - Intronic
935193265 2:100795013-100795035 CAGGGCCAGGAGACAGAGGGGGG - Intergenic
935270139 2:101427396-101427418 CAAAGCCAGCAAAGGCAGGCCGG - Intronic
935720120 2:105972611-105972633 CAGGTGCAGCAAAGGGAGCCAGG - Intergenic
936233796 2:110726107-110726129 GAAGGCCTGCAGAGGCAGGCTGG - Intergenic
936564350 2:113571609-113571631 CAGTGCCAGAAGAGGAAGTCAGG + Intergenic
937369340 2:121286650-121286672 CAGGAACAGCAGAGTGAGGGAGG - Intergenic
937577733 2:123444509-123444531 CAAGGCCAGCAGACTGAGGTGGG + Intergenic
938388450 2:130884769-130884791 CAGGGCCAGCAGAATGTTGCTGG + Intronic
938467391 2:131532647-131532669 CAGGGCAGGCAGATGGGGGCGGG + Exonic
940992677 2:160113959-160113981 CAAGGCGAGCAGAGTGAGCCTGG - Intronic
941568010 2:167132624-167132646 GATGGCCTGCAGAGGCAGGCCGG - Intronic
941643956 2:168019631-168019653 CAGTGCCTGCAGTGGGAGGATGG + Intronic
941918568 2:170828149-170828171 CGAGGACAGCAGAGGGAGGAGGG - Intronic
941918620 2:170828383-170828405 TGGGGACAGCAGAGGGAGGAGGG - Intronic
941918704 2:170828733-170828755 CGAGGACAGCAGAGGGAGGAGGG - Intronic
941918735 2:170828853-170828875 CAAGGACCGCAGAGGGAGGAAGG - Intronic
942997009 2:182275138-182275160 GAGGGTCAAAAGAGGGAGGCAGG + Intronic
942998146 2:182290552-182290574 TCAGGCAAGCAGAGGGAGGCTGG - Intronic
943238638 2:185356129-185356151 CAGGAGCAAGAGAGGGAGGCAGG - Intergenic
943299492 2:186180159-186180181 CAGGGGCAGTAGAGGGAGACAGG - Intergenic
945200420 2:207275546-207275568 GAAGGCCAGCAAAGGGAGGCAGG - Intergenic
945333684 2:208567244-208567266 CAGGGCCAGCAGACTCAGGTGGG - Intronic
945979138 2:216295111-216295133 CGGGGCCTGCAGACCGAGGCTGG + Intronic
946023822 2:216659927-216659949 CAGTGACAGCAGGGGGATGCTGG + Intronic
946183740 2:217965046-217965068 CAGGGCCAGCAGGTGGCTGCAGG + Intronic
946202190 2:218076807-218076829 GGGAGGCAGCAGAGGGAGGCAGG - Intronic
946245093 2:218382907-218382929 CTGGGCCACCAGAAAGAGGCAGG + Intronic
947538131 2:230953869-230953891 CACGGCCAGGAGATGAAGGCTGG + Intronic
947567799 2:231205937-231205959 CAGTCACAGCAGAGGGAGGGGGG - Intronic
947948220 2:234124765-234124787 CAGGGACAGCAGCAAGAGGCTGG - Intergenic
948251865 2:236535987-236536009 CTGGGCCAGCAGAGGGAGGTGGG + Intergenic
948756493 2:240162577-240162599 CAGGGCGGGTGGAGGGAGGCGGG + Intergenic
948894002 2:240919865-240919887 CAGGTCCAGCAGCTGGAGCCTGG + Intronic
948981133 2:241495420-241495442 CTGGGCCAGGAGAGGGAGGAGGG + Exonic
949036414 2:241817534-241817556 TGGGGCCAGCAGAGGGAAGGCGG + Intergenic
1168916333 20:1491291-1491313 CAGTGCCAGCAGCAGGAAGCAGG + Exonic
1169131126 20:3166914-3166936 TGGGGCCAGCAGGGAGAGGCCGG - Exonic
1169159067 20:3360982-3361004 CAATGACAGCAGAGGGTGGCAGG + Intronic
1169522342 20:6387287-6387309 CAGGGCCAGTAGACTGAGGTGGG - Intergenic
1170757263 20:19214972-19214994 CGGGGGCAACACAGGGAGGCTGG - Intronic
1171004876 20:21454527-21454549 ATGGGCTAGCAGAGGGAGGGAGG + Intergenic
1171179832 20:23084396-23084418 CAGGGCCAGCAGGAGTAGGATGG + Exonic
1171251581 20:23653107-23653129 CATGGTCACCATAGGGAGGCAGG - Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1172314537 20:33943556-33943578 CAGGGCTAGTAGGTGGAGGCTGG - Intergenic
1172511402 20:35503647-35503669 CAGGGCCTGCACAGGAAGGTAGG + Exonic
1172980148 20:38935382-38935404 CAGGGCCACCAGAGGGTGGCAGG - Intronic
1173191528 20:40880450-40880472 CAGGGGCACTAGAGGGAGACTGG + Intergenic
1173249008 20:41354766-41354788 CAGGGCCAGCACAGGGCGGGAGG + Intronic
1173341401 20:42155828-42155850 CAGGGACAACAGAGGCAGGTAGG - Intronic
1173996878 20:47345402-47345424 CAGGGCCGGCCCAGGTAGGCAGG + Intronic
1174194080 20:48760631-48760653 CTGAGCCAGGAGAGGGAGGCTGG + Intronic
1174292879 20:49521444-49521466 CAGGGCCAGGAGAGCTGGGCAGG - Intronic
1174898483 20:54475258-54475280 CAGGGGCTGAAGGGGGAGGCGGG + Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175155234 20:56966847-56966869 TAGAGCCTGCAGAGGGAGGACGG - Intergenic
1175163036 20:57022812-57022834 AAGAGCCAGGAGAGGGAGACAGG - Intergenic
1175306750 20:57981485-57981507 CAGGGCAAGGTGAGTGAGGCGGG + Intergenic
1175522597 20:59611698-59611720 CTGGGGCCGGAGAGGGAGGCAGG - Intronic
1175839071 20:62015167-62015189 CAGACCCAACAGAGGGAGGGTGG + Intronic
1175902190 20:62364358-62364380 CACGAGCAGCAGAGGGAAGCTGG + Intronic
1175970337 20:62683331-62683353 CATGGCCAGCAGCGAGCGGCTGG - Intronic
1175974216 20:62702285-62702307 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175974240 20:62702355-62702377 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG + Intergenic
1176062124 20:63177007-63177029 CAGGGCCATCCGCAGGAGGCCGG + Intergenic
1176098941 20:63356294-63356316 CAGGGCCAGGACAGGGCAGCAGG + Intronic
1176231534 20:64035702-64035724 CCGGGCCAGCAGCGGGGGCCCGG + Intronic
1176866494 21:14057423-14057445 CAGGGCCAGGACAGGCAGGATGG + Intergenic
1178710411 21:34911748-34911770 CAGAGCAAGCCGAGGGAGACAGG - Intronic
1178976882 21:37227835-37227857 CAGGGCCAGCAGAGGCTGCGGGG + Intronic
1179029046 21:37703964-37703986 CAGGCCCAGCAGGGCAAGGCGGG - Intronic
1179582576 21:42352708-42352730 CAGGGCCAGGAGAGTGAGAGAGG - Intergenic
1180057370 21:45365820-45365842 CAAGGCCAGCAGACGGTGGGAGG - Intergenic
1180068346 21:45424003-45424025 CAGGTCCTGCAGACGGAGCCGGG + Intronic
1180074576 21:45456113-45456135 CAGGGCCTGCCCAGGGAGGGAGG - Exonic
1180095078 21:45552645-45552667 CAGCCCCAGCAGAGAGGGGCTGG + Intergenic
1180139928 21:45887003-45887025 AAGGGACAGCACAGTGAGGCTGG - Intronic
1180159344 21:45992161-45992183 CAGGGCCAGCCGGGAGAGCCTGG + Exonic
1180245201 21:46542692-46542714 AAGGGCCATCACAGGGAGGCAGG - Intronic
1180612405 22:17106565-17106587 CTTGGCCAGCAGAGGGCTGCAGG - Intronic
1180667905 22:17529315-17529337 CAGAGCAAGCACAGGAAGGCTGG + Intronic
1180709161 22:17828136-17828158 CTGGGCCTGCAGAAGCAGGCTGG - Intronic
1180950238 22:19717531-19717553 CAGGGCCACCTGAGGGCTGCAGG + Intronic
1180959623 22:19756737-19756759 CCGGGCCAGGTGAGGGAGGGAGG + Exonic
1180980829 22:19877262-19877284 CGGGGTCAGCACAGGGAGGGGGG + Intronic
1181005947 22:20013586-20013608 CATGGCCACCAGAGGGCAGCTGG - Intronic
1181041584 22:20195022-20195044 GAGGGCCTGCAGGGGGAGGGGGG - Intergenic
1181311281 22:21946211-21946233 CAGGGCCACTAGAGGGTGGAGGG + Intronic
1181496483 22:23290075-23290097 CAAGGACAGCAGAGGGGGTCGGG - Intronic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1181832322 22:25570716-25570738 CAGGAGAAGCAGAGGGGGGCCGG - Intronic
1182092287 22:27604038-27604060 CAGTGCCAGCCCAGGGAGGGGGG - Intergenic
1182421126 22:30249060-30249082 CATGGACAGGAGGGGGAGGCTGG - Intergenic
1182487224 22:30646790-30646812 GAGGGCCAGCAGGGAGAAGCTGG - Exonic
1182573142 22:31254173-31254195 CAGGCCCAGGAGAGGGAGCAGGG - Intronic
1182681857 22:32085737-32085759 CAGGGCCAGCAGGGCGGGGCAGG + Intronic
1183036002 22:35141439-35141461 TTGGGCCAGAGGAGGGAGGCTGG - Intergenic
1183293435 22:37016686-37016708 CAAGGCCAGGAGAGGGCTGCAGG + Intronic
1183352613 22:37342567-37342589 CAGGGGCAGCAGTGGGACCCAGG - Intergenic
1183546171 22:38455688-38455710 CAGCGCGGGCAGAGGGAGGCGGG - Intergenic
1183579494 22:38715424-38715446 CTGGGCCTGCAGAAGGAGGAAGG - Intronic
1183584656 22:38745936-38745958 CAGAGGCATCAGAGGGATGCAGG + Intronic
1183725994 22:39590018-39590040 CTGGGCCTGCAGAAGGAGGGTGG + Intronic
1184030790 22:41893171-41893193 CAGAGCCAGCGCAGGGAGTCAGG - Exonic
1184111532 22:42398314-42398336 CAGTGACAGCAGAGGAAGACTGG - Intronic
1184112536 22:42403757-42403779 CAAGGCCAGCTGTGTGAGGCCGG - Intronic
1184652600 22:45925968-45925990 CAGGGACAGGGGAGGGAGGAGGG - Intronic
1184663384 22:45975786-45975808 CGGGGCCAGCAGCGGGCGGTGGG + Intronic
1184921800 22:47610443-47610465 CAGGAGCAGCTGAGGAAGGCAGG - Intergenic
1184927246 22:47651477-47651499 CAGGGCAAGAACAGGGTGGCAGG + Intergenic
1184979155 22:48084035-48084057 GAGGGTCTGCAGAGGCAGGCAGG - Intergenic
1184982752 22:48105825-48105847 CAGGGAGAGCAGAGGGATGTGGG - Intergenic
1184985546 22:48130868-48130890 ACGGGGCTGCAGAGGGAGGCGGG - Intergenic
1185014052 22:48333257-48333279 AAGGGGAAGCAGAGTGAGGCTGG - Intergenic
1185072934 22:48667151-48667173 CAGGGGCAGCACAGGGCAGCAGG + Intronic
1185180516 22:49358182-49358204 CCGGGCCACCTGAGAGAGGCAGG + Intergenic
1185342580 22:50298258-50298280 CAAGGGCAGCACAGGGATGCTGG + Intronic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
949874700 3:8618580-8618602 CAGGCCTAGTTGAGGGAGGCTGG - Intergenic
950066467 3:10115824-10115846 GCGGGCCAGCAAGGGGAGGCGGG + Intronic
950139930 3:10608477-10608499 CAAGGCCAGTTGAGGGAGTCAGG - Intronic
950448978 3:13055054-13055076 CAGAGCCAGGACAGGAAGGCCGG - Intronic
950479997 3:13238208-13238230 CAGGACCAGGAGAGGAAAGCAGG - Intergenic
950540400 3:13609072-13609094 CAGAGCCAGGACAGGGCGGCGGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951145012 3:19216271-19216293 CAGTGCTAGCAGAGGCAGGCTGG + Intronic
951424066 3:22521308-22521330 CAGGGCCAGCTGGGGGAGGGGGG + Intergenic
951543821 3:23806600-23806622 CAGGGCGGCCAGAGGCAGGCAGG + Intronic
951752953 3:26057412-26057434 CTGGGACAGGAGAGGGAGCCAGG - Intergenic
951898422 3:27633058-27633080 CAGGGCCTGCAGCGGGAGCTGGG + Intergenic
952223860 3:31353372-31353394 TAAGGCCAGCAGATGCAGGCAGG - Intergenic
952333517 3:32385806-32385828 GAGGCCCAGCAGAGGGAGAGCGG - Intergenic
952430418 3:33218517-33218539 GTGGGCCAGGAGAGGGATGCTGG + Intronic
952655073 3:35776420-35776442 CAGGGAAAGCAGAGGAAGGGTGG + Intronic
952920834 3:38282740-38282762 CGGTCCCTGCAGAGGGAGGCTGG + Intronic
952948362 3:38496545-38496567 CTGGGCCAGCGAAGGGAGGACGG - Intronic
953860555 3:46540768-46540790 CAGGGCCACGAGAAGGGGGCAGG - Intronic
954136852 3:48585837-48585859 CAGGGCCAGAAGGGGGAACCTGG - Exonic
954199807 3:49017572-49017594 CAGGGCCAGAAAAGGCAGGAGGG - Intronic
954299428 3:49691529-49691551 CTGGCCCAGCAGAGTGAGGAGGG - Intronic
954380618 3:50217158-50217180 TAACTCCAGCAGAGGGAGGCAGG + Intronic
954425247 3:50439717-50439739 CAGGGTCTGCAGTTGGAGGCCGG + Intronic
954439618 3:50514711-50514733 CCAGACCTGCAGAGGGAGGCAGG + Intergenic
954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG + Intronic
954658772 3:52215156-52215178 CAGGGGCAGCACAGAGGGGCAGG - Intergenic
954688701 3:52384452-52384474 CAGGGCTCTCAGAGAGAGGCAGG + Intronic
954708890 3:52495333-52495355 CAGGCACAGCACAGGCAGGCGGG - Exonic
954808969 3:53236299-53236321 CAGGGGCAGCAGGAAGAGGCTGG + Intronic
954866993 3:53738084-53738106 CCCGACCAGCAGAGGGAGGCTGG + Intronic
954923185 3:54209331-54209353 AAGGGCCAGGAGGGTGAGGCTGG - Intronic
954956210 3:54520308-54520330 TTGGCCCAGCAGTGGGAGGCTGG + Intronic
955510977 3:59679935-59679957 CAGGGGCAGCAGGGGCAGGGAGG - Intergenic
955649007 3:61172901-61172923 AATGGCCAGCAGGGGCAGGCAGG + Intronic
955672363 3:61415272-61415294 CACTGGCAGCAGAGGGAGGGAGG + Intergenic
956587988 3:70884337-70884359 GAGGGCCAGCAGAGGCAGCACGG - Intergenic
956731835 3:72203701-72203723 CAAGGCCAGCAGGGAGAGGGAGG + Intergenic
957011353 3:75009190-75009212 GAGGGCCAGCAGAAGCAGGGTGG - Intergenic
957747757 3:84366595-84366617 GAGGGCCAGCAGAAGCAGGGTGG - Intergenic
957776415 3:84760854-84760876 CAGGGCAAGCAGAAGCAGGGTGG + Intergenic
958970109 3:100601627-100601649 CTGGGGCAGCAGAGGAAGTCAGG - Intergenic
959085627 3:101849107-101849129 CTGGGCCTGCAGAGGGAGGCGGG - Intronic
959585744 3:108023596-108023618 CAGCACCAGCAGAGTGGGGCAGG - Intergenic
960121709 3:113953891-113953913 CAGTGCCAGCACAGGAAGGGAGG - Exonic
960284370 3:115810718-115810740 CAGGGCCAACAGGAGGAGGCTGG - Intronic
960602145 3:119469085-119469107 CAGGGCCGCCAGAAGGAGTCAGG + Exonic
960963545 3:123089346-123089368 CAGGGGAAGGAGTGGGAGGCAGG + Intronic
961402710 3:126658310-126658332 TGGAGCCAGCAGATGGAGGCCGG + Intergenic
961645843 3:128392414-128392436 CGGGGCCTGCCCAGGGAGGCAGG + Intronic
961818397 3:129563012-129563034 AAGGCCCTGCAGAGGAAGGCTGG + Intronic
961820368 3:129572740-129572762 CAGGGGCAGCTGTGGGAGGAAGG + Exonic
961875776 3:130022429-130022451 CAGGGACAGCAAAGCGAGGACGG + Intergenic
961977431 3:131041947-131041969 GAGGGCGAGCAGAAGGAGGGTGG + Intronic
962242248 3:133759569-133759591 CAGTGCCTGCTTAGGGAGGCTGG + Intronic
962851407 3:139310953-139310975 CATGGCCAGTAGTGGGAAGCAGG + Intronic
963043287 3:141084478-141084500 CAGGGCAGGCAGGGGGAGGGGGG - Intronic
965143138 3:164864832-164864854 CAGGGCCAGCTGAATGAGGTGGG - Intergenic
966568641 3:181413423-181413445 AAGGGCAAGCAGAGGAAGGAAGG + Intergenic
966762305 3:183428758-183428780 CAGGACCCGGAGCGGGAGGCTGG + Intronic
966882268 3:184357274-184357296 GAAGAACAGCAGAGGGAGGCAGG + Intronic
966942637 3:184756608-184756630 CAGGGGCAGCACAGGGAGAACGG - Intergenic
967729001 3:192889581-192889603 TAGGGCCAGCAGAGGTAGGTAGG - Intronic
967823372 3:193859001-193859023 CAGGCCCCACAAAGGGAGGCAGG - Intergenic
968010638 3:195271639-195271661 GAGGCCGAGCGGAGGGAGGCTGG + Intergenic
968205329 3:196794643-196794665 CAGAGGCAGAGGAGGGAGGCGGG + Intronic
968477743 4:820392-820414 CTGGGCAAGAAGAGAGAGGCAGG + Intronic
968520856 4:1034142-1034164 CAGGTCCAACAGCGGGCGGCGGG + Intergenic
968603787 4:1522043-1522065 CAGGGGCAGCAGACGGACACAGG + Intergenic
968669731 4:1842654-1842676 CACAGGCAGCAGTGGGAGGCTGG + Intronic
968698078 4:2042332-2042354 CATGGCCAGCAGAGGGAGCGGGG - Exonic
968914484 4:3491356-3491378 CAGGGGGAGCAGAGGAAGGAAGG - Intronic
969271819 4:6108226-6108248 CAGAAGCAGCAGAGTGAGGCTGG + Intronic
969489334 4:7490318-7490340 CAGGCCTGGCAGAGGGAGGCAGG - Intronic
969616501 4:8255957-8255979 CAGGGGGAGGACAGGGAGGCAGG - Intergenic
969872161 4:10111398-10111420 CAGGGGAAGCAGAGGGTGGTGGG - Intronic
970441451 4:16083797-16083819 CGCGGCCGGCAGTGGGAGGCGGG - Intronic
970448044 4:16140258-16140280 CAGGGGTTTCAGAGGGAGGCTGG + Intergenic
971196536 4:24475606-24475628 CAGGGCCTGCAGAGGCATCCAGG + Intergenic
973878998 4:55249867-55249889 CAGGGCCTTCAGAGGGAGCACGG + Intergenic
974251862 4:59394798-59394820 GAGGGCCAGCAGAAGCAGGTTGG - Intergenic
974918923 4:68212625-68212647 AAGGGAGAGCAGAGGGAGGGAGG + Intergenic
975632782 4:76419519-76419541 CAGAGCCTCCAGAGGGAGGGAGG - Intronic
975661124 4:76689720-76689742 CTGGGCACGGAGAGGGAGGCGGG + Intronic
976015093 4:80542891-80542913 CAGGGGCAGCAGGGGCATGCAGG - Intronic
976092414 4:81471954-81471976 CGGGGCTGGCAGCGGGAGGCAGG - Intronic
976362981 4:84202471-84202493 GAGGGCCAGCAGAAGCAGGATGG + Intergenic
976547925 4:86359403-86359425 GAGGGGTAGCAGAGGGAGGGAGG - Intronic
976778989 4:88737837-88737859 CAGGGGCAGCGATGGGAGGCAGG - Intronic
977080666 4:92523707-92523729 CAGGTTCAGCAGAGGGACGCAGG + Intronic
977747647 4:100569468-100569490 CAGGGCAAGCAGAGGGAGATGGG - Intronic
978382070 4:108139563-108139585 CAGGGCCAGCAGGGCCAGGGTGG - Intronic
978385066 4:108169879-108169901 CAAAGCCAGAAGAGGGAGGGAGG + Intergenic
979518460 4:121638745-121638767 CTGGGCAAGCAGCAGGAGGCTGG - Intergenic
981310710 4:143295381-143295403 GAGGTACAGGAGAGGGAGGCTGG - Intergenic
982346135 4:154362226-154362248 AAGTGCCAGCACAGGTAGGCTGG + Intronic
983044602 4:162970167-162970189 GAGGGCCAGCAGAAGCAGGGTGG - Intergenic
983509602 4:168593301-168593323 CAGATCCAGCAGAGAGAAGCTGG - Intronic
983632115 4:169859971-169859993 GAGGGCCAGGAGAGGGGAGCGGG + Intergenic
985344281 4:188986630-188986652 ATGGGCATGCAGAGGGAGGCAGG - Intergenic
985348060 4:189027938-189027960 CAGGGCTAGCAGGTGGAGGGTGG - Intergenic
985445268 4:190018251-190018273 CTGGGCCAGAACAGGGGGGCAGG - Intergenic
985487255 5:158552-158574 CAGGACGGGCAGAGGGAGGAGGG - Intronic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985675756 5:1230512-1230534 CAGGGCCAGCATGTGGGGGCCGG - Intronic
985720018 5:1484055-1484077 CAGGGGCAGGTGAGGGCGGCGGG - Intronic
985732388 5:1556537-1556559 CAGGGCCAGCAGTGGGGTGCGGG + Intergenic
986174053 5:5336963-5336985 CATGGGCAGCACAGGGAGGAGGG + Intergenic
986299304 5:6465955-6465977 CCTGGGCAGCAGAGGGAGACAGG - Intronic
986729698 5:10626107-10626129 CAGGGGCCGGAGTGGGAGGCAGG + Intronic
986745003 5:10736160-10736182 CAGCGCCTGCAGAGGGAGTGTGG + Intronic
987485911 5:18526078-18526100 GAGGGCCAGCTGAGGAAAGCAGG + Intergenic
988536202 5:32071440-32071462 GTGGTCCAGCTGAGGGAGGCAGG - Intronic
988730505 5:33968162-33968184 GAGGGCCAGTAGAGGGCTGCAGG + Intronic
991275667 5:64843903-64843925 GAGGGGCAGCAGTGGGAGGCAGG - Intronic
991404642 5:66289819-66289841 CAGGGCTGGCAGAGAGAGGTAGG - Intergenic
991734413 5:69618658-69618680 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991780565 5:70128067-70128089 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
991810847 5:70473793-70473815 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991859853 5:71003490-71003512 TAGGGGCAGCAGAGGGAAGCTGG + Intronic
991873013 5:71128386-71128408 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
992265848 5:75017652-75017674 GAGGGACAGCGAAGGGAGGCAGG + Intergenic
992828205 5:80569925-80569947 CAGGGCCAGCCGAGGGCCGCCGG - Intronic
993560595 5:89402590-89402612 CAGGGGCAACAAAGGGAGACAGG + Intergenic
995831668 5:116361478-116361500 CAGGACCTGCGGAGGGAGGGAGG - Intronic
996570386 5:124927536-124927558 AAAGGACAGCAGAGTGAGGCTGG - Intergenic
997385245 5:133467371-133467393 CTGGGCCTGCAGGAGGAGGCTGG + Intronic
997681096 5:135751232-135751254 CAGGCCCAGGAGAAGGAGGAGGG - Intergenic
997980197 5:138464100-138464122 CAGGGACTGCAGGGGGAGCCCGG + Intergenic
998135354 5:139671494-139671516 CTGGGCCAGCCGCGGGTGGCGGG + Intronic
998147031 5:139734796-139734818 CTGGATCAGCAGAGGCAGGCAGG - Intergenic
998403921 5:141863085-141863107 CTGAGCCAGCAGTGGGAGGTGGG - Intronic
998834442 5:146190318-146190340 ATGGGTCAGCAGAGGTAGGCAGG + Intergenic
999652676 5:153783004-153783026 GAGGGCCAGCAGGGTCAGGCTGG + Intronic
999684426 5:154089484-154089506 CAGGGCTAGCAGAGGGATCCAGG - Intronic
1000041250 5:157486682-157486704 GAGTGCCAGCAGAGGGAGGAGGG - Intronic
1000103598 5:158037974-158037996 CAGTGGCATCAGAGGGAGACCGG + Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1001424509 5:171614672-171614694 CAGAGGCAGCAGTGGGAGGCTGG + Intergenic
1001537446 5:172508228-172508250 CAGAGCCTCCAGAGGGAGCCTGG + Intergenic
1002076690 5:176712639-176712661 CTGGGGCAGGAGAGGGAGGTGGG + Intergenic
1002101692 5:176861067-176861089 TAGGGATGGCAGAGGGAGGCTGG - Intronic
1002660795 5:180790154-180790176 CTGGGCCAGCAGAGGGCACCGGG + Intergenic
1002719099 5:181247029-181247051 CTGGGTCAGCAAAGGGAGCCCGG + Intronic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1003119011 6:3304883-3304905 CAGGGAGAGGAGAGGGATGCAGG + Intronic
1003422260 6:5969063-5969085 AAGGACCAGCACAGGGAGGGAGG + Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1004431234 6:15545934-15545956 CAGGGCCAGCTCAGGCAGGCGGG + Intronic
1005502502 6:26442122-26442144 CAAGGTCTGCAGAGGGAGGTGGG - Intronic
1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG + Intergenic
1006634566 6:35452622-35452644 CAGCGCCTGCAGCAGGAGGCGGG - Exonic
1007248958 6:40482755-40482777 CCTGGCCAGGAGGGGGAGGCAGG - Intronic
1007324387 6:41048945-41048967 AAGGGCCTGCAGAGACAGGCTGG + Intronic
1007547948 6:42708492-42708514 GAGGGCCAGTAGAGGGGAGCGGG - Intronic
1007704131 6:43780885-43780907 AAGGACCAGGGGAGGGAGGCAGG - Intronic
1007746107 6:44043854-44043876 CCTGGCAAGCTGAGGGAGGCAGG - Intergenic
1007751200 6:44073025-44073047 GAGGTGCAGCAGAGGCAGGCGGG + Intergenic
1009305982 6:62089522-62089544 GAGGGCGAGCAGAAGGAGGGTGG - Intronic
1009684355 6:66936947-66936969 CAGTGCCAGCAGAGGGTGGCAGG - Intergenic
1009775822 6:68205455-68205477 GAGGGCCAGCAGAAGCAGGGTGG + Intergenic
1010813685 6:80329615-80329637 CAGCACCAGCACAGGGAGGAGGG - Intronic
1011629691 6:89311711-89311733 CAGGGCCTGCACAGGGAGGAGGG - Intronic
1012553080 6:100482016-100482038 CAGGGACTCCAGAGGGAAGCGGG + Intergenic
1012637937 6:101570470-101570492 CAGGGGGAGAAGGGGGAGGCTGG - Intronic
1012878963 6:104762538-104762560 CAGGGCCTGCTGAGGGTGGGGGG + Intronic
1012976981 6:105791419-105791441 CACAGGCAGCAGAGGGAGGCTGG + Intergenic
1013652519 6:112210037-112210059 CATGGCCTGCAGTGGGAGGTGGG - Intronic
1013993194 6:116278460-116278482 CAGGTCCAGCAGAAGGTGGTAGG + Exonic
1014632527 6:123803891-123803913 CAGGGGCAGCAGCGGCAGCCTGG - Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015790058 6:136957613-136957635 CAGGGCCAGGAAAGGCAGGGAGG - Intergenic
1015790072 6:136957655-136957677 CAGGGCCAGGAAAGGCAGGGGGG - Intergenic
1017137560 6:151161652-151161674 CCAGGCCAGCAGCGGGAGGTGGG + Intergenic
1017775025 6:157673765-157673787 CCGGGGCTGCAGAGGGCGGCTGG + Exonic
1018794274 6:167173897-167173919 CAGCGGCAGCAGTGGGAAGCCGG + Exonic
1018822045 6:167381170-167381192 CAGCGGCAGCAGTGGGAAGCCGG - Exonic
1018901338 6:168053332-168053354 CAGAGCTGGCAGTGGGAGGCTGG - Intergenic
1018909937 6:168096089-168096111 CGGGGCCAGCACTGAGAGGCAGG + Intergenic
1019109035 6:169694993-169695015 CCCGGCCAGCAGAGGGAGAAGGG + Intronic
1019168841 6:170117325-170117347 CACGGCCCTCGGAGGGAGGCTGG - Intergenic
1019186523 6:170223766-170223788 GTGGACCAGCCGAGGGAGGCAGG + Intergenic
1019188493 6:170235936-170235958 CAGGGCCAGCTCAGGAAGGCTGG + Intergenic
1019335474 7:480641-480663 CAGGGGCAGCTCAGGCAGGCAGG + Intergenic
1019360779 7:603256-603278 CAGGCCCACCGCAGGGAGGCAGG + Intronic
1019427609 7:984799-984821 CAGGGCCAGCCCAGGGGGACGGG + Intronic
1019436683 7:1025816-1025838 CTGGGCCTCCAGAGGCAGGCTGG + Intronic
1019486839 7:1293294-1293316 CAGGGCCGGCAAAGGGGTGCAGG + Intergenic
1019507366 7:1399056-1399078 CAGGGCCACCAGAGCCAGGCTGG + Intergenic
1019911068 7:4100789-4100811 CTGGGCCTGGAGAGGGAGGCTGG + Intronic
1019922429 7:4171596-4171618 CAGGGCCAGAGTAGAGAGGCTGG + Intronic
1020290367 7:6718281-6718303 CTGGGACAGCAGAGGAAGGTGGG - Intergenic
1021085884 7:16421004-16421026 CAGGGCGGGGAGCGGGAGGCCGG + Intronic
1021505957 7:21385349-21385371 CAGGTATAACAGAGGGAGGCAGG - Intergenic
1021638550 7:22715183-22715205 CAGGGAGAGAGGAGGGAGGCAGG + Intergenic
1023004248 7:35846276-35846298 CAGGTCCAACAATGGGAGGCAGG - Intronic
1023539548 7:41250877-41250899 CAGGGACAGCACAGGGTGGGAGG + Intergenic
1023705849 7:42941202-42941224 CGGGGCCAGCAGAGGAACACAGG - Intronic
1023732882 7:43209073-43209095 CAGGGTTAGGAGTGGGAGGCGGG + Intronic
1023828851 7:44027957-44027979 CAGGGCCAGAAGAGAGGGACAGG + Intergenic
1023965994 7:44963272-44963294 CAGGGCCCCGAGAGGGAGGAGGG - Intronic
1024147602 7:46533215-46533237 CAGGGCCAGCAGACTGAGGTGGG + Intergenic
1024251327 7:47507846-47507868 CAGGGACAGCTGTGGGAGGAGGG + Intronic
1024270124 7:47635720-47635742 CAGGGCCAGGACAGGGAAGGAGG + Intergenic
1024288676 7:47783721-47783743 CAGGGCCTTCAGAGGGAGCGTGG + Intronic
1024698403 7:51880606-51880628 CAGGGCCTGCAGTGGGTGGGGGG - Intergenic
1025194925 7:56925278-56925300 CAGGACCAGAAGAGGGTGGAGGG - Intergenic
1025677027 7:63651665-63651687 CAGGACCAGAAGAGGGTGGAGGG + Intergenic
1025691870 7:63756964-63756986 CCGGGCCTGCAGACGGAGCCGGG - Intergenic
1025739461 7:64183670-64183692 CAGGGCCCTCCGAGGGAGTCAGG - Intronic
1025802682 7:64801909-64801931 CAGAGCCAAAAGAGGAAGGCAGG - Intronic
1026000720 7:66557737-66557759 AATGGCCAGTAGAGGGGGGCCGG + Intergenic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026822079 7:73556855-73556877 CAGGGAAATTAGAGGGAGGCTGG + Intronic
1027058194 7:75064837-75064859 TAGGGCCAGGAGGGGAAGGCGGG - Intronic
1028994629 7:97086162-97086184 CAGGGCAGGTAGAGGGAGGCAGG + Intergenic
1029064872 7:97839315-97839337 CAGGGGGAGCAGAGGAGGGCCGG + Intergenic
1029098367 7:98107080-98107102 CTGAGGCAGCGGAGGGAGGCAGG + Exonic
1029211876 7:98916030-98916052 CAGGGCCAGGGGAGGGGGGCAGG - Intronic
1029673203 7:102048214-102048236 CAGGACCAGGAGAGGGTGGAGGG - Intronic
1029705417 7:102273326-102273348 CATGGCCGTCAGAGGGAGCCTGG - Intronic
1029739151 7:102482214-102482236 CAGGGCCAGAAGAGAGGGACAGG + Intergenic
1029757152 7:102581393-102581415 CAGGGCCAGAAGAGAGGGACAGG + Exonic
1029775092 7:102680454-102680476 CAGGGCCAGAAGAGAGGGACAGG + Intergenic
1030627583 7:111860637-111860659 CAGGGCCAGCGTAGGGAAGCTGG - Intronic
1031717379 7:125125515-125125537 GAGGGCGAGCAGAAGCAGGCTGG - Intergenic
1032011891 7:128352344-128352366 CAGGTCCAGCAGCGCCAGGCAGG + Exonic
1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG + Intronic
1032542663 7:132716224-132716246 AAGGGCCACCAGAGAGAGTCTGG + Intronic
1032753145 7:134862912-134862934 CAGTGCCTTCAGAGGGAGCCTGG - Intronic
1032783883 7:135185694-135185716 CAGGGCCAGCAGAGCCAGGCTGG + Exonic
1033439655 7:141367147-141367169 GTGGACCAGCAGAGGGAGGAAGG + Intronic
1033576652 7:142691714-142691736 CAGTTCCATCAGATGGAGGCTGG + Intergenic
1033582702 7:142751619-142751641 CATGGGCAGCAGAGGGATGTGGG - Intronic
1033587683 7:142786604-142786626 CATGGCCTGCAGAGGATGGCAGG - Intergenic
1033648251 7:143321395-143321417 CAGGAACTGCAGAGGAAGGCTGG - Exonic
1034256526 7:149727759-149727781 CTGGGGCAACAGAGGGAGCCGGG - Intronic
1034397481 7:150838233-150838255 CAGGGCCATCAGTGGATGGCAGG + Intronic
1034781432 7:153886316-153886338 CAGGGGCAGCAGGTGGAGACGGG + Intergenic
1034875638 7:154722615-154722637 CAGGGGCGGCAGCAGGAGGCAGG + Intronic
1034987868 7:155528525-155528547 CAAGTCCAGCAGAGGGTGGGTGG + Intronic
1035043804 7:155951093-155951115 CACGGCCAGCAGAGTGAGCGTGG + Intergenic
1035108254 7:156459807-156459829 CAGGGGCAGAACAGGGCGGCGGG - Intergenic
1035275446 7:157745471-157745493 CAGGGCAGGCTCAGGGAGGCAGG + Intronic
1035307957 7:157945374-157945396 AAGGGCCTTCAGAGGCAGGCGGG - Intronic
1035649953 8:1256871-1256893 CAAGGCCTGTGGAGGGAGGCGGG - Intergenic
1035754753 8:2022912-2022934 CGGGGCAGACAGAGGGAGGCAGG - Intergenic
1035879901 8:3234657-3234679 CTGGGAGAGCAGAGGAAGGCAGG + Intronic
1036446826 8:8828950-8828972 ACGGGCCGGAAGAGGGAGGCAGG - Intronic
1036708464 8:11061932-11061954 CAGGGCCAGCCGAGGGACACAGG - Intronic
1036943337 8:13071678-13071700 AAGCGCCTGCAGAAGGAGGCAGG - Intergenic
1037905445 8:22713597-22713619 CAGGGGCCTGAGAGGGAGGCCGG + Intronic
1038201073 8:25413217-25413239 CAGGCCTAGCAGAGGAAAGCAGG - Exonic
1038798181 8:30727652-30727674 CGGCGCCAGCAGCGGGCGGCGGG + Exonic
1039518317 8:38151143-38151165 CAGGGCCAGGCGAGGGATGGAGG + Exonic
1039885990 8:41654142-41654164 CAGGGCCAGGAGAGAGAGACAGG - Intronic
1040832391 8:51691814-51691836 CCCGGCCAGCAGAGGGAGGAAGG + Intronic
1041359043 8:57030893-57030915 CAGCACCAGTAGTGGGAGGCAGG - Intergenic
1041659958 8:60391891-60391913 CATGGGCAGCAGGGGCAGGCAGG - Intergenic
1044278860 8:90333768-90333790 TGGGGCCTGCAGAGGCAGGCAGG - Intergenic
1045384846 8:101662334-101662356 CTGGGCGAGCAGAAGGAGACTGG - Intronic
1046103668 8:109643208-109643230 CAGGACCAGCATAGGGAAGTAGG - Intronic
1046988236 8:120415758-120415780 CAGGGCAAGCAGAGGATGCCTGG + Intronic
1047204916 8:122795354-122795376 CAGGGCTAGGCCAGGGAGGCAGG - Intronic
1047207001 8:122810602-122810624 AAGGGCCAGCAGTGAGGGGCAGG + Intronic
1047966927 8:130051829-130051851 CAGGGCAAGAAGAGGGTGGAGGG - Intergenic
1048282313 8:133114417-133114439 CAGTACTAGGAGAGGGAGGCAGG - Intronic
1048593729 8:135845111-135845133 CAGGGACAGGATAGGGAAGCTGG + Intergenic
1048885254 8:138904358-138904380 TTGGGCCAGCAGGGGGTGGCGGG - Intronic
1048899217 8:139021964-139021986 CAGGGCCAGGAGAGGGAGAGGGG + Intergenic
1049097339 8:140556819-140556841 CAGGCCCCGCAGCGCGAGGCAGG - Intronic
1049242415 8:141544770-141544792 CAGGGCCTGGGTAGGGAGGCAGG - Intergenic
1049248170 8:141573936-141573958 CAGGTCCAGCTGAGGCTGGCAGG - Intergenic
1049325222 8:142018051-142018073 GAGGGCAAGAAGAGGCAGGCAGG - Intergenic
1049444670 8:142624487-142624509 CAGGGCATCCAGACGGAGGCTGG + Intergenic
1049505502 8:142994293-142994315 CAGGACCAGGAGTGTGAGGCTGG + Intergenic
1049565322 8:143335039-143335061 CAGGGAAACCAGGGGGAGGCCGG - Intronic
1049572618 8:143376351-143376373 CAGGGGCAGCAGTGGGATCCGGG - Intronic
1049684151 8:143932601-143932623 CAGGGCCAGCCGGGGGAGGTGGG - Intronic
1049687360 8:143944297-143944319 TGGGGACAGCAGGGGGAGGCTGG - Intronic
1049694661 8:143977355-143977377 TGGAGCCCGCAGAGGGAGGCAGG + Exonic
1049708843 8:144054776-144054798 CTGCCCCAGCAGAGGCAGGCGGG + Intronic
1049812187 8:144580572-144580594 CAGGGCCAGGTGAGGGCGGTGGG - Intronic
1049888075 9:41599-41621 CAGTGCCAGAAGAGGAAGTCAGG - Intergenic
1051122420 9:13765799-13765821 CAGCCCCAGCAGAGTAAGGCGGG - Intergenic
1052359181 9:27536060-27536082 TAGGGCCAGAAGAGAGAGGTAGG - Intergenic
1052824690 9:33166635-33166657 CTGATCCAGAAGAGGGAGGCTGG + Intronic
1052828721 9:33197438-33197460 CAAGGCCAGGACTGGGAGGCTGG + Intergenic
1052901688 9:33799024-33799046 CAGGGCCACCAGAGTCACGCTGG - Exonic
1053054264 9:34984906-34984928 CAGAGTCAGAGGAGGGAGGCAGG + Intergenic
1053297603 9:36925906-36925928 CGGGGCCAGCAGAATGAGGGTGG - Intronic
1053432975 9:38055621-38055643 CATTGCCAGCATAGGCAGGCAGG - Intronic
1053464893 9:38298740-38298762 CAGGGCCGGCCATGGGAGGCAGG - Intergenic
1053897142 9:42753694-42753716 CAGAGCCAGCAGGGGGTGGCAGG + Intergenic
1054266843 9:62925861-62925883 CGGAGCCAGCAGGGGGTGGCGGG + Intergenic
1054550336 9:66595315-66595337 CGGAGCCAGCAGGGGGTGGCGGG + Intergenic
1054934884 9:70676585-70676607 CAGGGCCAGCTGAGAGGAGCAGG + Intronic
1055110836 9:72557671-72557693 CAGGGACAGCAGTGGGAGTAGGG + Intronic
1056135002 9:83622972-83622994 AAGGGGCAGGAGAGAGAGGCCGG + Intergenic
1056766201 9:89446216-89446238 CAGAGGCAGCAGAGGGAGATCGG - Intronic
1057209783 9:93193461-93193483 CCGAGCCAGCAGGTGGAGGCTGG + Intronic
1057747130 9:97761341-97761363 GATTGGCAGCAGAGGGAGGCAGG + Intergenic
1058146345 9:101416066-101416088 CAGGGCCCTCAGGGGGAGGGGGG - Intergenic
1058539395 9:105995752-105995774 CAGGGCCAGGATGGGGACGCTGG + Intergenic
1058729489 9:107836241-107836263 CAGTGCCAGGAGAGTGTGGCTGG - Intergenic
1059414634 9:114155440-114155462 AGGGGGCAGCAGAGGGCGGCCGG + Intergenic
1059466255 9:114470627-114470649 CAGGGACAGAACAGAGAGGCTGG + Intronic
1059932441 9:119274280-119274302 TAAGGCCAGCAAAGGGACGCTGG - Intronic
1060257004 9:122040074-122040096 AAGGGCCAGCAGAGGCTGCCTGG - Intronic
1060485251 9:124042343-124042365 CAGGGCCAGGAGGGGGAGGCAGG - Intergenic
1060521490 9:124296552-124296574 CAGGAGCAGAAGAGGCAGGCAGG + Intronic
1060807765 9:126588266-126588288 CAGGCTCTGCACAGGGAGGCTGG - Intergenic
1060817774 9:126644388-126644410 CAGGCTCAGAAGAGGGAGGGGGG + Intronic
1060903064 9:127278761-127278783 CACGGCCCTCAGAGGGAGGATGG - Intronic
1060940601 9:127541002-127541024 CAGGTCCAGCATGGGGAGGTGGG + Intronic
1060978205 9:127777554-127777576 CTGGGGCAGCAGAGGGATGGGGG - Intronic
1061002483 9:127910215-127910237 CAAGGCCAGCAGTGGGTGACAGG + Intronic
1061034218 9:128104519-128104541 CAAGGCCACAAGAGGGAGGGAGG - Intronic
1061034463 9:128105993-128106015 CAGGGACAGCAGGGCGAGGCAGG + Intronic
1061089772 9:128420355-128420377 CAGGGCCGCCAGAGGGCGCCCGG + Intronic
1061219640 9:129242767-129242789 CAAGGACAGCTGAGGGAGGATGG + Intergenic
1061237625 9:129351834-129351856 CAGGGCCAGCAAGGGGGAGCCGG - Intergenic
1061796284 9:133087542-133087564 CAGGCCCAGGAGTGGGAGTCAGG + Intergenic
1061808136 9:133147866-133147888 CAGGACCAGCAGAGGGAAAGAGG - Intronic
1061869541 9:133513423-133513445 GAGGCCCAGCCGAGGGAGCCCGG + Intergenic
1061875679 9:133542404-133542426 CAGGGCATGCAGAGGGAGAGTGG + Intronic
1061948132 9:133920224-133920246 AAGGGCCAGGAGAGAGAGTCCGG + Intronic
1061954484 9:133954543-133954565 CAGGTCCAGCCATGGGAGGCTGG + Intronic
1061998971 9:134206535-134206557 CAGGGCCAGAGCAGGGAGCCGGG - Intergenic
1062246355 9:135569022-135569044 CAGGGCCTGCAGAGAGACCCTGG + Intergenic
1062352190 9:136144666-136144688 CAGGGCCCGGAGTGGGTGGCGGG - Intergenic
1062439533 9:136563505-136563527 CAGAGCCAGCTGGGGCAGGCTGG + Intergenic
1062572322 9:137191377-137191399 CAGTGCCAGCTCTGGGAGGCTGG + Intergenic
1062596766 9:137303025-137303047 CGTGGGCAGCAGAGGGAGGCAGG - Intergenic
1185775569 X:2800403-2800425 CAGGGCCAGCAGACTGAGGTGGG - Intronic
1185790502 X:2925326-2925348 TAGGGCCCCCAGAGGGAGCCCGG + Intronic
1186876869 X:13825901-13825923 GAGGGCCAGCTGTGGGTGGCAGG + Intronic
1187114413 X:16334463-16334485 CAGGAGCAACAGAGTGAGGCAGG + Intergenic
1187490657 X:19748333-19748355 CAGCGCCAGCATTGTGAGGCTGG + Intronic
1187900797 X:24025434-24025456 CGGGGCCCGCCCAGGGAGGCGGG + Intronic
1188061583 X:25607188-25607210 CTGGGCCTGAAGAGGGAGGCAGG - Intergenic
1188276478 X:28207292-28207314 CAGAGCCTACAGAGGCAGGCAGG - Intergenic
1188397987 X:29708386-29708408 CAGAGGCTGCAGAGGGGGGCAGG - Intronic
1188620745 X:32220105-32220127 CAGGCCCACAAGAGGGAGGCAGG + Intronic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1190214420 X:48470222-48470244 GGGGGCCCCCAGAGGGAGGCAGG + Intronic
1190303048 X:49067482-49067504 CAGGGGCAGCTGAGCTAGGCCGG - Exonic
1190480226 X:50870147-50870169 CTGTGCCTGCAGAGAGAGGCAGG + Intergenic
1190685577 X:52869654-52869676 CAGGGCAAGCACAGGTAGACTGG + Intergenic
1192495840 X:71616286-71616308 CAGAGCCGGCAGAGGGAGGGAGG + Exonic
1192832671 X:74767161-74767183 TAGGCCCAGCAGAGGGTGGCTGG + Intronic
1193144156 X:78060026-78060048 CAGACCCAGGAGAGGGAGGAGGG + Intergenic
1195667937 X:107447747-107447769 CAGGGACTGGAGAGGGAGCCAGG - Intergenic
1195688676 X:107606513-107606535 CAGGGGCAGCACAGTCAGGCTGG + Intergenic
1195704574 X:107729647-107729669 CTGGGCCGACAGAGGGAGGCAGG + Intronic
1196441508 X:115723427-115723449 CAGGGCGGGCAGAGGGAGAAGGG + Intergenic
1196445039 X:115841416-115841438 CAGGGCGGGCAGAGGGAGAAGGG + Intergenic
1197051097 X:122060879-122060901 GAGGGCCAGCAGAAGCAGGGTGG + Intergenic
1197460780 X:126737937-126737959 CAGCTCCAGGAGAGGGAGGGAGG - Intergenic
1197471142 X:126866382-126866404 CAAGTCCAGCAAAGAGAGGCTGG - Intergenic
1198069133 X:133130518-133130540 CTGGGGCAGGAGAGGGAGGAGGG + Intergenic
1198497721 X:137209786-137209808 CAGGTCCAGAAGCAGGAGGCGGG + Intergenic
1198636929 X:138711406-138711428 GGGGGCCAGAGGAGGGAGGCGGG + Exonic
1198801552 X:140452791-140452813 CAGGGGTAGCAGAGGCAGGAAGG + Intergenic
1199800791 X:151248645-151248667 CAGAGCCAGAAGGGGGAAGCTGG + Intergenic
1200075157 X:153547111-153547133 CCGGGGCAGAAGAGGGAGGTGGG + Intronic
1200090269 X:153632731-153632753 CCAGGCCAGCTGAGGGAGACTGG + Intergenic
1200194752 X:154240186-154240208 CAGGGAAAGAAGAGGAAGGCAGG + Intergenic
1201294348 Y:12450954-12450976 CAGGACCAGCAGACTGAGGTGGG + Intergenic
1201382097 Y:13392058-13392080 CAGGGGCTGAAGAGGGAGGATGG + Intronic