ID: 1160907162

View in Genome Browser
Species Human (GRCh38)
Location 19:1456780-1456802
Sequence AGGGCTCCGACCGGGTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 53}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160907143_1160907162 24 Left 1160907143 19:1456733-1456755 CCCCCAGGTGGGCGTGGGGCTGC 0: 1
1: 0
2: 2
3: 51
4: 320
Right 1160907162 19:1456780-1456802 AGGGCTCCGACCGGGTTTCCAGG 0: 1
1: 0
2: 1
3: 2
4: 53
1160907156_1160907162 2 Left 1160907156 19:1456755-1456777 CCCTTGGGGACGGGGCAGGGGTC 0: 1
1: 1
2: 1
3: 20
4: 257
Right 1160907162 19:1456780-1456802 AGGGCTCCGACCGGGTTTCCAGG 0: 1
1: 0
2: 1
3: 2
4: 53
1160907145_1160907162 22 Left 1160907145 19:1456735-1456757 CCCAGGTGGGCGTGGGGCTGCCC 0: 1
1: 1
2: 15
3: 31
4: 320
Right 1160907162 19:1456780-1456802 AGGGCTCCGACCGGGTTTCCAGG 0: 1
1: 0
2: 1
3: 2
4: 53
1160907144_1160907162 23 Left 1160907144 19:1456734-1456756 CCCCAGGTGGGCGTGGGGCTGCC 0: 1
1: 0
2: 2
3: 51
4: 294
Right 1160907162 19:1456780-1456802 AGGGCTCCGACCGGGTTTCCAGG 0: 1
1: 0
2: 1
3: 2
4: 53
1160907157_1160907162 1 Left 1160907157 19:1456756-1456778 CCTTGGGGACGGGGCAGGGGTCA 0: 1
1: 0
2: 3
3: 42
4: 357
Right 1160907162 19:1456780-1456802 AGGGCTCCGACCGGGTTTCCAGG 0: 1
1: 0
2: 1
3: 2
4: 53
1160907146_1160907162 21 Left 1160907146 19:1456736-1456758 CCAGGTGGGCGTGGGGCTGCCCT 0: 1
1: 0
2: 4
3: 37
4: 332
Right 1160907162 19:1456780-1456802 AGGGCTCCGACCGGGTTTCCAGG 0: 1
1: 0
2: 1
3: 2
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160907162 Original CRISPR AGGGCTCCGACCGGGTTTCC AGG Intronic
901635155 1:10667102-10667124 AGGCCTCTCATCGGGTTTCCTGG - Intronic
901646330 1:10718683-10718705 AGGACTCCGGCAGGGTCTCCTGG - Intronic
905037867 1:34929462-34929484 CGGGCTCCGGCCGGGTTACATGG + Exonic
1068225091 10:54097918-54097940 AGAGCTCTGACTGAGTTTCCTGG - Intronic
1078580338 11:12534770-12534792 AGGCCTTTGACAGGGTTTCCAGG - Intergenic
1080057783 11:27925278-27925300 GGGGCCCCCACCGGGTTGCCTGG + Intergenic
1083767984 11:64851300-64851322 TGGGCTCCGACCGGGGTTCAGGG - Intergenic
1084323653 11:68386964-68386986 AGGGCTCCCTCCAGGTCTCCAGG - Intronic
1085296808 11:75436030-75436052 AGGGCTCCGATGAGGTTCCCAGG - Intronic
1089127371 11:116186202-116186224 GTGGCTCCGACCGGTTGTCCTGG + Intergenic
1091780074 12:3208206-3208228 AGGGCTCCAACCGCCCTTCCTGG - Intronic
1092256342 12:6928338-6928360 CTGGCTCCGAGCGGGATTCCGGG - Intronic
1092766493 12:11857738-11857760 AGGGTTAGGACCTGGTTTCCCGG - Intronic
1103329251 12:120142533-120142555 TGGGCTCCTGCTGGGTTTCCTGG - Exonic
1105964828 13:25374162-25374184 AGCACTCCCTCCGGGTTTCCGGG - Intronic
1121645949 14:95516925-95516947 AGGGCTCCGGGCTGCTTTCCAGG - Intronic
1128861043 15:71072507-71072529 AGGGGCCCGAGCGGGTTTCTGGG + Intergenic
1129034582 15:72641644-72641666 AGGGCTCATACCGGGGTTCTGGG - Intergenic
1129215300 15:74095572-74095594 AGGGCTCATACCGGGGTTCTGGG + Intergenic
1129392339 15:75226635-75226657 AGGGCTCAGACCTGGGTTCTGGG - Intergenic
1129472060 15:75761548-75761570 AGGGCTCAGACCTGGGTTCTGGG + Intergenic
1129680745 15:77657195-77657217 AGGGCTCAGACAGGGATGCCTGG + Intronic
1132644060 16:990754-990776 AGGGGACCGTCCGGGATTCCCGG + Intergenic
1138555104 16:57766342-57766364 AGGGCTGAGACAGGCTTTCCTGG - Intronic
1149852915 17:60051807-60051829 AGGACCCAGACTGGGTTTCCAGG - Intronic
1151600779 17:75104833-75104855 AGGGCTCAGACCCAGGTTCCTGG - Intronic
1152383007 17:79951925-79951947 AGGGCTCAGAACTGGATTCCAGG - Intronic
1160835218 19:1121818-1121840 AGGGCTCCGGCTTGGTTTCTTGG - Intronic
1160907162 19:1456780-1456802 AGGGCTCCGACCGGGTTTCCAGG + Intronic
1161102936 19:2430288-2430310 AGCGCACCGGCCGGGTTTCTCGG - Exonic
1161400467 19:4064871-4064893 TGGGCGCCGACTGGGTGTCCGGG + Intronic
1163020953 19:14480514-14480536 GGGGCTCTGCCCTGGTTTCCGGG + Intronic
1163721688 19:18900912-18900934 AGGGCTCTGGCTGGGTCTCCTGG - Intronic
1166743208 19:45126529-45126551 AGAGCTCAGGCCTGGTTTCCAGG + Intronic
1167661080 19:50796504-50796526 AGGGCTCCCTACGGGTTCCCTGG - Intergenic
926226723 2:10972045-10972067 CGAGCTCCTCCCGGGTTTCCTGG - Intergenic
1175913010 20:62413608-62413630 AGGGGTCCCACCGGCTGTCCAGG - Intronic
1181435358 22:22907205-22907227 AGGGAGCCCACCCGGTTTCCTGG - Intergenic
1183261483 22:36798527-36798549 AGGGCTCTGACCTGGTTTCCGGG + Intergenic
954410787 3:50370030-50370052 AGGGCTCCTGCCTGGTTGCCTGG + Intronic
954892575 3:53944694-53944716 TGGGCTCCTACCGGGCTCCCAGG + Intergenic
970950939 4:21754586-21754608 AGGGCTCAGACCAGGTCTTCTGG + Intronic
992474264 5:77087119-77087141 CCGGCTCCGGCCGCGTTTCCCGG - Exonic
1001755327 5:174164142-174164164 TGGGCTTCGACCCAGTTTCCTGG - Intronic
1005510260 6:26506204-26506226 AGGGCTCTGTCTAGGTTTCCAGG + Intronic
1011094069 6:83638177-83638199 GTGGCTCCGAGCAGGTTTCCCGG + Intronic
1011635519 6:89369135-89369157 AGGGCACCGTCTCGGTTTCCAGG + Intronic
1020395867 7:7716979-7717001 GGGGTCCCGAACGGGTTTCCGGG - Intronic
1021969445 7:25951636-25951658 AGGGCTCCGGCTGGGTTTGGAGG - Intergenic
1035206234 7:157295555-157295577 AGGCCTGCGAGCGGGTATCCTGG + Intergenic
1037612894 8:20491318-20491340 TGGGCTCAGACTGGGTTCCCTGG + Intergenic
1053305598 9:36982408-36982430 AGGGCTGAGACTGGGTTCCCTGG - Intronic
1059433953 9:114265464-114265486 AGGGCTCTTACCGGTTCTCCTGG - Exonic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1187722489 X:22165692-22165714 AGGGCTCTGACCAGATTCCCTGG - Intronic
1190775472 X:53549139-53549161 AGAGCTCCAACCAGCTTTCCTGG - Exonic
1198299947 X:135325477-135325499 AGGGCTGCGAGCGGGCTTGCAGG + Intronic