ID: 1160907868

View in Genome Browser
Species Human (GRCh38)
Location 19:1460255-1460277
Sequence CTGGCGCTGCGCCGCTACGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160907862_1160907868 -6 Left 1160907862 19:1460238-1460260 CCCGGGACCCGCTGAACCTGGCG 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1160907868 19:1460255-1460277 CTGGCGCTGCGCCGCTACGCGGG 0: 1
1: 0
2: 0
3: 3
4: 63
1160907863_1160907868 -7 Left 1160907863 19:1460239-1460261 CCGGGACCCGCTGAACCTGGCGC 0: 1
1: 0
2: 0
3: 6
4: 115
Right 1160907868 19:1460255-1460277 CTGGCGCTGCGCCGCTACGCGGG 0: 1
1: 0
2: 0
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160907868 Original CRISPR CTGGCGCTGCGCCGCTACGC GGG Exonic
900557375 1:3287308-3287330 CTGGAGCCGCCCCGCCACGCGGG + Intronic
900557389 1:3287355-3287377 CTGGAGCCGCCCCGCCACGCGGG + Intronic
900557403 1:3287402-3287424 CTGGAGCCGCCCCGCCACGCGGG + Intronic
900557431 1:3287497-3287519 CTGGAGCCGCCCCGCCACGCGGG + Intronic
907289286 1:53402540-53402562 CTGGAGCTGGGCCTCTACGAAGG + Intergenic
920496883 1:206461220-206461242 CTGGCGCTGCGCTGGAAGGCGGG - Exonic
1063565878 10:7172002-7172024 CGGGCTCTGAGCCGCTCCGCAGG + Exonic
1070804497 10:79263128-79263150 CTGTCACTGCGCCACTGCGCTGG - Intronic
1070912782 10:80132793-80132815 CTGGCCCTGCTCCGCGCCGCGGG + Exonic
1075587218 10:123666601-123666623 CTGCCGCTGCGCCACGACGCCGG - Exonic
1085266732 11:75241832-75241854 CCTGCGCTGCGCCGCCCCGCGGG + Exonic
1100829370 12:98503849-98503871 CTGGCGGGGCGCCACTAAGCCGG - Exonic
1102256602 12:111418809-111418831 CTGGCGCTGCGCCGGGCCCCGGG + Exonic
1103446705 12:120999597-120999619 CTGGCGCTGAGCCGGTGGGCCGG - Exonic
1104602448 12:130162666-130162688 CTCGCGCCGGGCCGCTGCGCCGG + Exonic
1104772359 12:131371405-131371427 CTGGCGCTGCTGCGCTCCACAGG - Intergenic
1106246534 13:27954528-27954550 CTGGGTCTGCGCCGCTGCCCGGG - Intergenic
1110195596 13:72784614-72784636 CAGGCGCAGCACCACTACGCGGG - Intronic
1114046490 14:18880715-18880737 CTGGCCCTGCTCTGCTCCGCGGG + Intergenic
1114117722 14:19638735-19638757 CTGGCCCTGCTCTGCTCCGCGGG - Intergenic
1116145933 14:41069165-41069187 CTGCCCCTGAGCTGCTACGCTGG - Intergenic
1117549094 14:56816753-56816775 CTCGAGCTGCGCCGCCCCGCTGG + Intergenic
1118610163 14:67533432-67533454 CTGGGGCTGCGCCGCGGCGGAGG + Intronic
1118957713 14:70497881-70497903 CTTCCTCTGCGCCGCTAAGCTGG + Intergenic
1119318403 14:73714323-73714345 CAGGCGCTGCGCGGCTGCTCTGG + Exonic
1125698893 15:41662087-41662109 CTAGCGCTGTTCCGATACGCAGG - Intronic
1130572788 15:85063434-85063456 CTGGCACTGGGCTGCTACCCAGG - Intronic
1134024648 16:10944650-10944672 CGGGCGCTGGGCCGCTCTGCTGG + Exonic
1137661468 16:50210408-50210430 CAGGCGCTGCGCCTATCCGCAGG + Intronic
1141063773 16:80897928-80897950 CTGGCGCTTCACAGCTGCGCTGG - Intergenic
1144763934 17:17722869-17722891 GTCGCGCTGCGCCGCGACCCCGG + Intronic
1146400180 17:32495417-32495439 CTGGAGCTGGGCCGCTTGGCTGG + Intronic
1150806615 17:68324453-68324475 CTGGAGCTGGGCCGGTCCGCAGG - Intronic
1152581176 17:81166191-81166213 CTGGCGCCGCGGGGCTCCGCTGG + Intergenic
1152644253 17:81461468-81461490 CTGGCGCTGCGCAAGTACGCGGG + Exonic
1152729310 17:81961789-81961811 CTGGCCCTGCGCCGTCCCGCTGG + Intronic
1160633304 18:80262451-80262473 CTGTCTCTGCGCCGCGCCGCCGG + Intergenic
1160907868 19:1460255-1460277 CTGGCGCTGCGCCGCTACGCGGG + Exonic
927055343 2:19361270-19361292 CGGGCACTGCGCAGCGACGCAGG - Intergenic
948423863 2:237876104-237876126 CTGGAGCTGCCCCGATGCGCCGG - Intronic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1180144557 21:45912109-45912131 CTGGCACTGCACCGGGACGCAGG - Intronic
1180465026 22:15603351-15603373 CTGGCCCTGCTCTGCTCCGCGGG + Intergenic
1183440214 22:37818708-37818730 CTGGCGTTGCCCTGCTGCGCTGG + Intergenic
954249531 3:49357466-49357488 CTGACGGTGTGCCCCTACGCAGG - Exonic
956678219 3:71754457-71754479 CTGGCCGTGCGCCGCCATGCTGG + Exonic
960674003 3:120177410-120177432 CTGGCGCTGCCTCGCTGCCCTGG + Intronic
961515041 3:127427068-127427090 CTGGCTCTGCGCCTCAGCGCTGG - Intergenic
963253115 3:143120160-143120182 GAGGGGCTGCGCCGCTATGCCGG + Exonic
973197574 4:47463373-47463395 CTGGAGCTGCACCTCTAGGCTGG + Intronic
984952870 4:185019705-185019727 CAGGCGCTGGGCCGCTGCGAGGG + Exonic
999367630 5:151033442-151033464 CTGGCTCTGGGCTGCTACCCAGG - Intronic
1001563202 5:172683562-172683584 CTGGCGCTGGGCCGCGCCCCGGG + Exonic
1006465363 6:34190831-34190853 CTGGCGCTGCTCCTCTGCCCGGG - Intergenic
1006932543 6:37696833-37696855 CTCGGGCTGCGCCGCCTCGCGGG - Exonic
1018429492 6:163712383-163712405 CTGCCGCTGAGAAGCTACGCTGG + Intergenic
1023558197 7:41445119-41445141 CAGGCGCCCCGCCACTACGCCGG - Intergenic
1025916823 7:65873043-65873065 GTGGCGCTGCGCCGCGCGGCCGG - Intergenic
1026009494 7:66625838-66625860 CTGCCTCTGAGCTGCTACGCTGG + Intergenic
1033640993 7:143263346-143263368 CTGGCCCTGCCCCGCTGCGCCGG + Intronic
1050292649 9:4172249-4172271 CTGGAGCTGAGCCACTACCCTGG - Intronic
1052611107 9:30774496-30774518 CTGGCGCTACCCCTCTGCGCGGG - Intergenic
1054782036 9:69174337-69174359 CCGGAGCTGCGCGCCTACGCGGG + Intronic
1058885781 9:109320501-109320523 CTGCCGCTGCGCCGCCGCCCGGG + Exonic
1061075740 9:128340534-128340556 CTGGGGCTGCGCTGCGCCGCCGG + Intergenic
1061609938 9:131739703-131739725 CTGGGGCTCCGCCGCTCCCCGGG - Intronic
1186829755 X:13378813-13378835 CTGACGGTGTGCCCCTACGCAGG - Intergenic