ID: 1160908061

View in Genome Browser
Species Human (GRCh38)
Location 19:1460994-1461016
Sequence GTGTGGTGGGACTAGGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 194}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160908061_1160908077 18 Left 1160908061 19:1460994-1461016 CCTGGACCCTAGTCCCACCACAC 0: 1
1: 0
2: 0
3: 19
4: 194
Right 1160908077 19:1461035-1461057 AGGTGGTGTCCAGCATCCTTCGG 0: 1
1: 0
2: 3
3: 16
4: 182
1160908061_1160908079 30 Left 1160908061 19:1460994-1461016 CCTGGACCCTAGTCCCACCACAC 0: 1
1: 0
2: 0
3: 19
4: 194
Right 1160908079 19:1461047-1461069 GCATCCTTCGGAACTTGTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1160908061_1160908067 -2 Left 1160908061 19:1460994-1461016 CCTGGACCCTAGTCCCACCACAC 0: 1
1: 0
2: 0
3: 19
4: 194
Right 1160908067 19:1461015-1461037 ACTTGCCCCTCACCCCACCCAGG 0: 1
1: 0
2: 6
3: 57
4: 382
1160908061_1160908068 1 Left 1160908061 19:1460994-1461016 CCTGGACCCTAGTCCCACCACAC 0: 1
1: 0
2: 0
3: 19
4: 194
Right 1160908068 19:1461018-1461040 TGCCCCTCACCCCACCCAGGTGG 0: 1
1: 0
2: 6
3: 72
4: 454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160908061 Original CRISPR GTGTGGTGGGACTAGGGTCC AGG (reversed) Intronic