ID: 1160908062

View in Genome Browser
Species Human (GRCh38)
Location 19:1461000-1461022
Sequence GGGCAAGTGTGGTGGGACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 172}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160908062_1160908080 27 Left 1160908062 19:1461000-1461022 CCCTAGTCCCACCACACTTGCCC 0: 1
1: 0
2: 2
3: 17
4: 172
Right 1160908080 19:1461050-1461072 TCCTTCGGAACTTGTCCTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 54
1160908062_1160908077 12 Left 1160908062 19:1461000-1461022 CCCTAGTCCCACCACACTTGCCC 0: 1
1: 0
2: 2
3: 17
4: 172
Right 1160908077 19:1461035-1461057 AGGTGGTGTCCAGCATCCTTCGG 0: 1
1: 0
2: 3
3: 16
4: 182
1160908062_1160908079 24 Left 1160908062 19:1461000-1461022 CCCTAGTCCCACCACACTTGCCC 0: 1
1: 0
2: 2
3: 17
4: 172
Right 1160908079 19:1461047-1461069 GCATCCTTCGGAACTTGTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1160908062_1160908067 -8 Left 1160908062 19:1461000-1461022 CCCTAGTCCCACCACACTTGCCC 0: 1
1: 0
2: 2
3: 17
4: 172
Right 1160908067 19:1461015-1461037 ACTTGCCCCTCACCCCACCCAGG 0: 1
1: 0
2: 6
3: 57
4: 382
1160908062_1160908082 28 Left 1160908062 19:1461000-1461022 CCCTAGTCCCACCACACTTGCCC 0: 1
1: 0
2: 2
3: 17
4: 172
Right 1160908082 19:1461051-1461073 CCTTCGGAACTTGTCCTGGAGGG 0: 1
1: 0
2: 1
3: 7
4: 63
1160908062_1160908068 -5 Left 1160908062 19:1461000-1461022 CCCTAGTCCCACCACACTTGCCC 0: 1
1: 0
2: 2
3: 17
4: 172
Right 1160908068 19:1461018-1461040 TGCCCCTCACCCCACCCAGGTGG 0: 1
1: 0
2: 6
3: 72
4: 454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160908062 Original CRISPR GGGCAAGTGTGGTGGGACTA GGG (reversed) Intronic