ID: 1160908064

View in Genome Browser
Species Human (GRCh38)
Location 19:1461007-1461029
Sequence GGGTGAGGGGCAAGTGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 552
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 503}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160908064_1160908082 21 Left 1160908064 19:1461007-1461029 CCCACCACACTTGCCCCTCACCC 0: 1
1: 0
2: 3
3: 45
4: 503
Right 1160908082 19:1461051-1461073 CCTTCGGAACTTGTCCTGGAGGG 0: 1
1: 0
2: 1
3: 7
4: 63
1160908064_1160908079 17 Left 1160908064 19:1461007-1461029 CCCACCACACTTGCCCCTCACCC 0: 1
1: 0
2: 3
3: 45
4: 503
Right 1160908079 19:1461047-1461069 GCATCCTTCGGAACTTGTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1160908064_1160908080 20 Left 1160908064 19:1461007-1461029 CCCACCACACTTGCCCCTCACCC 0: 1
1: 0
2: 3
3: 45
4: 503
Right 1160908080 19:1461050-1461072 TCCTTCGGAACTTGTCCTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 54
1160908064_1160908077 5 Left 1160908064 19:1461007-1461029 CCCACCACACTTGCCCCTCACCC 0: 1
1: 0
2: 3
3: 45
4: 503
Right 1160908077 19:1461035-1461057 AGGTGGTGTCCAGCATCCTTCGG 0: 1
1: 0
2: 3
3: 16
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160908064 Original CRISPR GGGTGAGGGGCAAGTGTGGT GGG (reversed) Intronic