ID: 1160908065

View in Genome Browser
Species Human (GRCh38)
Location 19:1461008-1461030
Sequence GGGGTGAGGGGCAAGTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 979
Summary {0: 1, 1: 1, 2: 5, 3: 97, 4: 875}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160908065_1160908079 16 Left 1160908065 19:1461008-1461030 CCACCACACTTGCCCCTCACCCC 0: 1
1: 1
2: 5
3: 97
4: 875
Right 1160908079 19:1461047-1461069 GCATCCTTCGGAACTTGTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1160908065_1160908077 4 Left 1160908065 19:1461008-1461030 CCACCACACTTGCCCCTCACCCC 0: 1
1: 1
2: 5
3: 97
4: 875
Right 1160908077 19:1461035-1461057 AGGTGGTGTCCAGCATCCTTCGG 0: 1
1: 0
2: 3
3: 16
4: 182
1160908065_1160908082 20 Left 1160908065 19:1461008-1461030 CCACCACACTTGCCCCTCACCCC 0: 1
1: 1
2: 5
3: 97
4: 875
Right 1160908082 19:1461051-1461073 CCTTCGGAACTTGTCCTGGAGGG 0: 1
1: 0
2: 1
3: 7
4: 63
1160908065_1160908080 19 Left 1160908065 19:1461008-1461030 CCACCACACTTGCCCCTCACCCC 0: 1
1: 1
2: 5
3: 97
4: 875
Right 1160908080 19:1461050-1461072 TCCTTCGGAACTTGTCCTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160908065 Original CRISPR GGGGTGAGGGGCAAGTGTGG TGG (reversed) Intronic