ID: 1160908066

View in Genome Browser
Species Human (GRCh38)
Location 19:1461011-1461033
Sequence GGTGGGGTGAGGGGCAAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1334
Summary {0: 1, 1: 0, 2: 12, 3: 145, 4: 1176}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160908066_1160908082 17 Left 1160908066 19:1461011-1461033 CCACACTTGCCCCTCACCCCACC 0: 1
1: 0
2: 12
3: 145
4: 1176
Right 1160908082 19:1461051-1461073 CCTTCGGAACTTGTCCTGGAGGG 0: 1
1: 0
2: 1
3: 7
4: 63
1160908066_1160908080 16 Left 1160908066 19:1461011-1461033 CCACACTTGCCCCTCACCCCACC 0: 1
1: 0
2: 12
3: 145
4: 1176
Right 1160908080 19:1461050-1461072 TCCTTCGGAACTTGTCCTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 54
1160908066_1160908077 1 Left 1160908066 19:1461011-1461033 CCACACTTGCCCCTCACCCCACC 0: 1
1: 0
2: 12
3: 145
4: 1176
Right 1160908077 19:1461035-1461057 AGGTGGTGTCCAGCATCCTTCGG 0: 1
1: 0
2: 3
3: 16
4: 182
1160908066_1160908079 13 Left 1160908066 19:1461011-1461033 CCACACTTGCCCCTCACCCCACC 0: 1
1: 0
2: 12
3: 145
4: 1176
Right 1160908079 19:1461047-1461069 GCATCCTTCGGAACTTGTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160908066 Original CRISPR GGTGGGGTGAGGGGCAAGTG TGG (reversed) Intronic