ID: 1160908070

View in Genome Browser
Species Human (GRCh38)
Location 19:1461021-1461043
Sequence ACACCACCTGGGTGGGGTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 326}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160908070_1160908079 3 Left 1160908070 19:1461021-1461043 CCCTCACCCCACCCAGGTGGTGT 0: 1
1: 0
2: 2
3: 32
4: 326
Right 1160908079 19:1461047-1461069 GCATCCTTCGGAACTTGTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1160908070_1160908077 -9 Left 1160908070 19:1461021-1461043 CCCTCACCCCACCCAGGTGGTGT 0: 1
1: 0
2: 2
3: 32
4: 326
Right 1160908077 19:1461035-1461057 AGGTGGTGTCCAGCATCCTTCGG 0: 1
1: 0
2: 3
3: 16
4: 182
1160908070_1160908080 6 Left 1160908070 19:1461021-1461043 CCCTCACCCCACCCAGGTGGTGT 0: 1
1: 0
2: 2
3: 32
4: 326
Right 1160908080 19:1461050-1461072 TCCTTCGGAACTTGTCCTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 54
1160908070_1160908082 7 Left 1160908070 19:1461021-1461043 CCCTCACCCCACCCAGGTGGTGT 0: 1
1: 0
2: 2
3: 32
4: 326
Right 1160908082 19:1461051-1461073 CCTTCGGAACTTGTCCTGGAGGG 0: 1
1: 0
2: 1
3: 7
4: 63
1160908070_1160908084 28 Left 1160908070 19:1461021-1461043 CCCTCACCCCACCCAGGTGGTGT 0: 1
1: 0
2: 2
3: 32
4: 326
Right 1160908084 19:1461072-1461094 GGCCGACATCAACAGCAAGAAGG 0: 1
1: 0
2: 0
3: 11
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160908070 Original CRISPR ACACCACCTGGGTGGGGTGA GGG (reversed) Exonic