ID: 1160908071

View in Genome Browser
Species Human (GRCh38)
Location 19:1461022-1461044
Sequence GACACCACCTGGGTGGGGTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 11, 3: 64, 4: 362}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160908071_1160908080 5 Left 1160908071 19:1461022-1461044 CCTCACCCCACCCAGGTGGTGTC 0: 1
1: 0
2: 11
3: 64
4: 362
Right 1160908080 19:1461050-1461072 TCCTTCGGAACTTGTCCTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 54
1160908071_1160908079 2 Left 1160908071 19:1461022-1461044 CCTCACCCCACCCAGGTGGTGTC 0: 1
1: 0
2: 11
3: 64
4: 362
Right 1160908079 19:1461047-1461069 GCATCCTTCGGAACTTGTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1160908071_1160908077 -10 Left 1160908071 19:1461022-1461044 CCTCACCCCACCCAGGTGGTGTC 0: 1
1: 0
2: 11
3: 64
4: 362
Right 1160908077 19:1461035-1461057 AGGTGGTGTCCAGCATCCTTCGG 0: 1
1: 0
2: 3
3: 16
4: 182
1160908071_1160908084 27 Left 1160908071 19:1461022-1461044 CCTCACCCCACCCAGGTGGTGTC 0: 1
1: 0
2: 11
3: 64
4: 362
Right 1160908084 19:1461072-1461094 GGCCGACATCAACAGCAAGAAGG 0: 1
1: 0
2: 0
3: 11
4: 72
1160908071_1160908082 6 Left 1160908071 19:1461022-1461044 CCTCACCCCACCCAGGTGGTGTC 0: 1
1: 0
2: 11
3: 64
4: 362
Right 1160908082 19:1461051-1461073 CCTTCGGAACTTGTCCTGGAGGG 0: 1
1: 0
2: 1
3: 7
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160908071 Original CRISPR GACACCACCTGGGTGGGGTG AGG (reversed) Exonic