ID: 1160908074

View in Genome Browser
Species Human (GRCh38)
Location 19:1461029-1461051
Sequence GATGCTGGACACCACCTGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 156}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160908074_1160908080 -2 Left 1160908074 19:1461029-1461051 CCACCCAGGTGGTGTCCAGCATC 0: 1
1: 0
2: 1
3: 14
4: 156
Right 1160908080 19:1461050-1461072 TCCTTCGGAACTTGTCCTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 54
1160908074_1160908086 28 Left 1160908074 19:1461029-1461051 CCACCCAGGTGGTGTCCAGCATC 0: 1
1: 0
2: 1
3: 14
4: 156
Right 1160908086 19:1461080-1461102 TCAACAGCAAGAAGGTGCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 227
1160908074_1160908087 29 Left 1160908074 19:1461029-1461051 CCACCCAGGTGGTGTCCAGCATC 0: 1
1: 0
2: 1
3: 14
4: 156
Right 1160908087 19:1461081-1461103 CAACAGCAAGAAGGTGCTGAGGG 0: 1
1: 0
2: 2
3: 23
4: 287
1160908074_1160908082 -1 Left 1160908074 19:1461029-1461051 CCACCCAGGTGGTGTCCAGCATC 0: 1
1: 0
2: 1
3: 14
4: 156
Right 1160908082 19:1461051-1461073 CCTTCGGAACTTGTCCTGGAGGG 0: 1
1: 0
2: 1
3: 7
4: 63
1160908074_1160908079 -5 Left 1160908074 19:1461029-1461051 CCACCCAGGTGGTGTCCAGCATC 0: 1
1: 0
2: 1
3: 14
4: 156
Right 1160908079 19:1461047-1461069 GCATCCTTCGGAACTTGTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1160908074_1160908084 20 Left 1160908074 19:1461029-1461051 CCACCCAGGTGGTGTCCAGCATC 0: 1
1: 0
2: 1
3: 14
4: 156
Right 1160908084 19:1461072-1461094 GGCCGACATCAACAGCAAGAAGG 0: 1
1: 0
2: 0
3: 11
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160908074 Original CRISPR GATGCTGGACACCACCTGGG TGG (reversed) Exonic