ID: 1160908075

View in Genome Browser
Species Human (GRCh38)
Location 19:1461032-1461054
Sequence AAGGATGCTGGACACCACCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 189}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160908075_1160908088 29 Left 1160908075 19:1461032-1461054 CCCAGGTGGTGTCCAGCATCCTT 0: 1
1: 0
2: 1
3: 27
4: 189
Right 1160908088 19:1461084-1461106 CAGCAAGAAGGTGCTGAGGGAGG 0: 1
1: 1
2: 3
3: 48
4: 462
1160908075_1160908084 17 Left 1160908075 19:1461032-1461054 CCCAGGTGGTGTCCAGCATCCTT 0: 1
1: 0
2: 1
3: 27
4: 189
Right 1160908084 19:1461072-1461094 GGCCGACATCAACAGCAAGAAGG 0: 1
1: 0
2: 0
3: 11
4: 72
1160908075_1160908087 26 Left 1160908075 19:1461032-1461054 CCCAGGTGGTGTCCAGCATCCTT 0: 1
1: 0
2: 1
3: 27
4: 189
Right 1160908087 19:1461081-1461103 CAACAGCAAGAAGGTGCTGAGGG 0: 1
1: 0
2: 2
3: 23
4: 287
1160908075_1160908080 -5 Left 1160908075 19:1461032-1461054 CCCAGGTGGTGTCCAGCATCCTT 0: 1
1: 0
2: 1
3: 27
4: 189
Right 1160908080 19:1461050-1461072 TCCTTCGGAACTTGTCCTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 54
1160908075_1160908082 -4 Left 1160908075 19:1461032-1461054 CCCAGGTGGTGTCCAGCATCCTT 0: 1
1: 0
2: 1
3: 27
4: 189
Right 1160908082 19:1461051-1461073 CCTTCGGAACTTGTCCTGGAGGG 0: 1
1: 0
2: 1
3: 7
4: 63
1160908075_1160908086 25 Left 1160908075 19:1461032-1461054 CCCAGGTGGTGTCCAGCATCCTT 0: 1
1: 0
2: 1
3: 27
4: 189
Right 1160908086 19:1461080-1461102 TCAACAGCAAGAAGGTGCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 227
1160908075_1160908079 -8 Left 1160908075 19:1461032-1461054 CCCAGGTGGTGTCCAGCATCCTT 0: 1
1: 0
2: 1
3: 27
4: 189
Right 1160908079 19:1461047-1461069 GCATCCTTCGGAACTTGTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160908075 Original CRISPR AAGGATGCTGGACACCACCT GGG (reversed) Exonic