ID: 1160908079

View in Genome Browser
Species Human (GRCh38)
Location 19:1461047-1461069
Sequence GCATCCTTCGGAACTTGTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 51}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160908072_1160908079 -3 Left 1160908072 19:1461027-1461049 CCCCACCCAGGTGGTGTCCAGCA 0: 1
1: 0
2: 4
3: 21
4: 216
Right 1160908079 19:1461047-1461069 GCATCCTTCGGAACTTGTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1160908069_1160908079 4 Left 1160908069 19:1461020-1461042 CCCCTCACCCCACCCAGGTGGTG 0: 1
1: 0
2: 4
3: 49
4: 393
Right 1160908079 19:1461047-1461069 GCATCCTTCGGAACTTGTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1160908062_1160908079 24 Left 1160908062 19:1461000-1461022 CCCTAGTCCCACCACACTTGCCC 0: 1
1: 0
2: 2
3: 17
4: 172
Right 1160908079 19:1461047-1461069 GCATCCTTCGGAACTTGTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1160908074_1160908079 -5 Left 1160908074 19:1461029-1461051 CCACCCAGGTGGTGTCCAGCATC 0: 1
1: 0
2: 1
3: 14
4: 156
Right 1160908079 19:1461047-1461069 GCATCCTTCGGAACTTGTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1160908064_1160908079 17 Left 1160908064 19:1461007-1461029 CCCACCACACTTGCCCCTCACCC 0: 1
1: 0
2: 3
3: 45
4: 503
Right 1160908079 19:1461047-1461069 GCATCCTTCGGAACTTGTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1160908070_1160908079 3 Left 1160908070 19:1461021-1461043 CCCTCACCCCACCCAGGTGGTGT 0: 1
1: 0
2: 2
3: 32
4: 326
Right 1160908079 19:1461047-1461069 GCATCCTTCGGAACTTGTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1160908065_1160908079 16 Left 1160908065 19:1461008-1461030 CCACCACACTTGCCCCTCACCCC 0: 1
1: 1
2: 5
3: 97
4: 875
Right 1160908079 19:1461047-1461069 GCATCCTTCGGAACTTGTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1160908075_1160908079 -8 Left 1160908075 19:1461032-1461054 CCCAGGTGGTGTCCAGCATCCTT 0: 1
1: 0
2: 1
3: 27
4: 189
Right 1160908079 19:1461047-1461069 GCATCCTTCGGAACTTGTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1160908063_1160908079 23 Left 1160908063 19:1461001-1461023 CCTAGTCCCACCACACTTGCCCC 0: 1
1: 0
2: 1
3: 36
4: 298
Right 1160908079 19:1461047-1461069 GCATCCTTCGGAACTTGTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1160908061_1160908079 30 Left 1160908061 19:1460994-1461016 CCTGGACCCTAGTCCCACCACAC 0: 1
1: 0
2: 0
3: 19
4: 194
Right 1160908079 19:1461047-1461069 GCATCCTTCGGAACTTGTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1160908073_1160908079 -4 Left 1160908073 19:1461028-1461050 CCCACCCAGGTGGTGTCCAGCAT 0: 1
1: 0
2: 2
3: 7
4: 132
Right 1160908079 19:1461047-1461069 GCATCCTTCGGAACTTGTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1160908071_1160908079 2 Left 1160908071 19:1461022-1461044 CCTCACCCCACCCAGGTGGTGTC 0: 1
1: 0
2: 11
3: 64
4: 362
Right 1160908079 19:1461047-1461069 GCATCCTTCGGAACTTGTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1160908076_1160908079 -9 Left 1160908076 19:1461033-1461055 CCAGGTGGTGTCCAGCATCCTTC 0: 1
1: 0
2: 0
3: 16
4: 168
Right 1160908079 19:1461047-1461069 GCATCCTTCGGAACTTGTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1160908066_1160908079 13 Left 1160908066 19:1461011-1461033 CCACACTTGCCCCTCACCCCACC 0: 1
1: 0
2: 12
3: 145
4: 1176
Right 1160908079 19:1461047-1461069 GCATCCTTCGGAACTTGTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160908079 Original CRISPR GCATCCTTCGGAACTTGTCC TGG Exonic
900427845 1:2588563-2588585 GCATCCAGGGGAACTTGTCTGGG + Exonic
901807896 1:11749483-11749505 ACATCCTTTGGGACTTGTTCAGG + Intronic
903836232 1:26204828-26204850 GCATCCTTGGCAAACTGTCCAGG + Intergenic
906528642 1:46510952-46510974 GCTTCTTCCGGAACTTGGCCCGG - Exonic
908814949 1:68022210-68022232 GCATCCTTAGCAAAGTGTCCTGG + Intergenic
920530640 1:206699578-206699600 GCCTCCTTCGTGACTTCTCCTGG - Intronic
920751330 1:208680220-208680242 TCATCCTGCGGAGCTTGCCCAGG - Intergenic
1066101879 10:32124813-32124835 CCATCATTTGGGACTTGTCCTGG + Intergenic
1067019831 10:42785607-42785629 GCCTCATTCGGAACTTTACCCGG + Exonic
1067499494 10:46789621-46789643 GCCTCATTCGGAACTTCACCTGG + Intergenic
1067595135 10:47550701-47550723 GCCTCATTCGGAACTTCACCTGG - Intergenic
1067642244 10:48058784-48058806 GCCTCATTCGGAACTTCACCTGG - Intergenic
1068770298 10:60813504-60813526 GCACCATTTGGAATTTGTCCTGG + Intergenic
1068775473 10:60863835-60863857 GCATCCTTTTAAACTTGTCTGGG + Intergenic
1069599150 10:69692375-69692397 GCCTCCATGGGAACTTCTCCCGG - Exonic
1070139436 10:73727336-73727358 GCCTCATTCGGAACTTCACCCGG - Intergenic
1076272957 10:129171327-129171349 TCATCATTAGGAATTTGTCCTGG - Intergenic
1080640869 11:34157591-34157613 GCAGCTTTAGGAACATGTCCAGG - Intronic
1083436537 11:62647155-62647177 GCTTCATTCGGGACTTCTCCAGG - Exonic
1083836637 11:65273402-65273424 GCATCCTTGAGAACTGGTACTGG + Intronic
1086654561 11:89337308-89337330 GCCTCCTTTGGAATATGTCCAGG - Intronic
1090655223 11:128838101-128838123 GCATCATTCCGAATGTGTCCTGG - Intronic
1113685016 13:112277075-112277097 GCATCCTGAGGAAATGGTCCAGG - Intergenic
1121862861 14:97336005-97336027 GCATCCTTCTGTCCTGGTCCTGG - Intergenic
1129409026 15:75338717-75338739 GCAACCCTGGGAACTTGGCCTGG + Intronic
1132375277 15:101324621-101324643 GCATCACTTGGAACTTCTCCTGG + Intronic
1150470162 17:65430604-65430626 GCATCCTTTGGAAGATGCCCAGG + Intergenic
1152651586 17:81496541-81496563 GCATCATTATGAACTTGTCTGGG - Intergenic
1153940767 18:9974501-9974523 GCATCATTAGGTAGTTGTCCTGG + Intergenic
1155437111 18:25825049-25825071 GCAACCTTGGAAACTTCTCCTGG + Intergenic
1160908079 19:1461047-1461069 GCATCCTTCGGAACTTGTCCTGG + Exonic
1161744053 19:6044114-6044136 GCATCCTTCAGAGATTGTTCTGG + Intronic
1165764586 19:38342879-38342901 GCATCCCTGGGAGGTTGTCCAGG + Intronic
930692438 2:54378336-54378358 GCAGCCTCCGGAGCTTATCCAGG + Intronic
942402154 2:175614379-175614401 GTATCCTTCCAAACTTATCCTGG - Intergenic
1170771071 20:19332902-19332924 GCATCCTCCCTAAATTGTCCTGG - Intronic
1185372895 22:50469135-50469157 GCATCCTTCGGTGGTCGTCCTGG - Intronic
951749220 3:26015241-26015263 GCAGCCTTTGGGACTTGTACTGG + Intergenic
953030598 3:39177626-39177648 GTTTCCTTTGGAACTTTTCCAGG + Intergenic
953390492 3:42531102-42531124 GCAACCTGAGGGACTTGTCCTGG - Intronic
966148988 3:176845277-176845299 GGAGTCTTCGGAACTTGGCCAGG + Intergenic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
992199191 5:74367495-74367517 ACATCCTTGGGAATTTGTCCTGG - Intergenic
1009721712 6:67480406-67480428 ACATATTTTGGAACTTGTCCAGG + Intergenic
1016658228 6:146544435-146544457 GCAGCCTTCTCAACTAGTCCTGG - Intronic
1030335479 7:108321194-108321216 GCATCCTTGGGAACGTTCCCTGG - Intronic
1035746980 8:1968122-1968144 GCATCCTCTTGAACTTGTCTGGG - Intergenic
1049492175 8:142911229-142911251 GCATCCTCGGGACCTTCTCCAGG + Exonic
1050272068 9:3956978-3957000 CCATCCTTGAGAACTTGCCCTGG + Intronic
1055560986 9:77521524-77521546 GCATCCTTAAGAAATTCTCCTGG + Intronic
1059297848 9:113288232-113288254 GCATCCTTCAGGACGTTTCCTGG + Exonic
1061848424 9:133400882-133400904 GGATCATCAGGAACTTGTCCAGG - Intronic
1194744491 X:97613373-97613395 ACATCCTTCAGAATTTGGCCTGG + Intergenic