ID: 1160909219

View in Genome Browser
Species Human (GRCh38)
Location 19:1467206-1467228
Sequence CCCGGCGCCCCCGCCGCGCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 0, 3: 50, 4: 354}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160909219_1160909239 26 Left 1160909219 19:1467206-1467228 CCGAGCGCGGCGGGGGCGCCGGG 0: 1
1: 0
2: 0
3: 50
4: 354
Right 1160909239 19:1467255-1467277 CCGGCGGCGGGAGGAGGGGCCGG 0: 1
1: 1
2: 15
3: 143
4: 1158
1160909219_1160909226 1 Left 1160909219 19:1467206-1467228 CCGAGCGCGGCGGGGGCGCCGGG 0: 1
1: 0
2: 0
3: 50
4: 354
Right 1160909226 19:1467230-1467252 GCGCCGGCCTCCACTTTGCAGGG 0: 1
1: 0
2: 0
3: 6
4: 82
1160909219_1160909237 22 Left 1160909219 19:1467206-1467228 CCGAGCGCGGCGGGGGCGCCGGG 0: 1
1: 0
2: 0
3: 50
4: 354
Right 1160909237 19:1467251-1467273 GGCACCGGCGGCGGGAGGAGGGG 0: 1
1: 1
2: 6
3: 74
4: 604
1160909219_1160909230 10 Left 1160909219 19:1467206-1467228 CCGAGCGCGGCGGGGGCGCCGGG 0: 1
1: 0
2: 0
3: 50
4: 354
Right 1160909230 19:1467239-1467261 TCCACTTTGCAGGGCACCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 179
1160909219_1160909225 0 Left 1160909219 19:1467206-1467228 CCGAGCGCGGCGGGGGCGCCGGG 0: 1
1: 0
2: 0
3: 50
4: 354
Right 1160909225 19:1467229-1467251 GGCGCCGGCCTCCACTTTGCAGG 0: 1
1: 0
2: 1
3: 5
4: 73
1160909219_1160909233 14 Left 1160909219 19:1467206-1467228 CCGAGCGCGGCGGGGGCGCCGGG 0: 1
1: 0
2: 0
3: 50
4: 354
Right 1160909233 19:1467243-1467265 CTTTGCAGGGCACCGGCGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 123
1160909219_1160909235 20 Left 1160909219 19:1467206-1467228 CCGAGCGCGGCGGGGGCGCCGGG 0: 1
1: 0
2: 0
3: 50
4: 354
Right 1160909235 19:1467249-1467271 AGGGCACCGGCGGCGGGAGGAGG 0: 1
1: 0
2: 4
3: 35
4: 478
1160909219_1160909228 7 Left 1160909219 19:1467206-1467228 CCGAGCGCGGCGGGGGCGCCGGG 0: 1
1: 0
2: 0
3: 50
4: 354
Right 1160909228 19:1467236-1467258 GCCTCCACTTTGCAGGGCACCGG 0: 1
1: 0
2: 1
3: 21
4: 229
1160909219_1160909232 13 Left 1160909219 19:1467206-1467228 CCGAGCGCGGCGGGGGCGCCGGG 0: 1
1: 0
2: 0
3: 50
4: 354
Right 1160909232 19:1467242-1467264 ACTTTGCAGGGCACCGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 93
1160909219_1160909234 17 Left 1160909219 19:1467206-1467228 CCGAGCGCGGCGGGGGCGCCGGG 0: 1
1: 0
2: 0
3: 50
4: 354
Right 1160909234 19:1467246-1467268 TGCAGGGCACCGGCGGCGGGAGG 0: 1
1: 0
2: 1
3: 21
4: 233
1160909219_1160909236 21 Left 1160909219 19:1467206-1467228 CCGAGCGCGGCGGGGGCGCCGGG 0: 1
1: 0
2: 0
3: 50
4: 354
Right 1160909236 19:1467250-1467272 GGGCACCGGCGGCGGGAGGAGGG 0: 1
1: 0
2: 6
3: 47
4: 472

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160909219 Original CRISPR CCCGGCGCCCCCGCCGCGCT CGG (reversed) Exonic
900100791 1:961175-961197 GCCGGCGCCCCCGTCGCACCAGG + Intronic
900101204 1:962876-962898 CCCGGCCCCCTCGCAGCGCCGGG - Exonic
900190082 1:1349520-1349542 CCCGGCCCCGCCCCCGCGCGCGG + Intergenic
900221645 1:1512354-1512376 CCCGCGGTCCCCGCCGCCCTCGG - Exonic
900237601 1:1600138-1600160 CCCCGCGCCCCGTGCGCGCTCGG + Intergenic
900237613 1:1600162-1600184 CCCGCCTCCGCCGCCGCGCCGGG - Intergenic
900787067 1:4655724-4655746 CCAGGCGCGCCCGCAGCTCTAGG + Intronic
901057401 1:6455100-6455122 CCCAGCGCCGCCGCCGCCCACGG + Intronic
901373173 1:8817699-8817721 CCCGCCGCCCACTCCCCGCTCGG + Intergenic
901844056 1:11971107-11971129 CCCTGCCCCCCCGCCCCTCTAGG - Intronic
902044273 1:13513553-13513575 GCCTGCGCCGCCGCGGCGCTCGG - Exonic
902067543 1:13700452-13700474 CCCGGGGCCCCCGGCACGCCCGG - Intronic
902476958 1:16693379-16693401 CCCAGCGCCGCCGCCGCCCACGG - Intergenic
902586194 1:17439808-17439830 GCCGGCGCCCCCGCCCCGCCCGG + Intergenic
902994485 1:20213100-20213122 TCCGGCGCCTCCGCTGTGCTCGG - Intergenic
903907389 1:26696448-26696470 CCCGCCGCCGCCGCCGCCCTCGG + Exonic
904011461 1:27392706-27392728 CCCCGCGGCCCGGCCGCGCCTGG + Exonic
904485940 1:30824609-30824631 GCCGGCGCCCCCGCCGGGGCGGG + Intergenic
904772209 1:32886633-32886655 CCCAGCGCCCCCGCCACCCGGGG - Intronic
904822950 1:33256821-33256843 GCCGCCGCCGCCGCCGCTCTGGG - Intronic
907501958 1:54887384-54887406 CCTGGCACCCCCGCCTCGCGCGG - Intergenic
908356825 1:63330297-63330319 CCCGGCGACCCATCCGGGCTGGG + Intergenic
912716876 1:111989533-111989555 CCCGGCGCCCCGCGCGCGCGAGG + Intergenic
912955874 1:114153809-114153831 ACCCGCGCCCCGGCCGCACTGGG + Intronic
913186440 1:116373800-116373822 CTCGGAGCCCCCGGCCCGCTCGG - Intronic
914066852 1:144250430-144250452 CCCGGTGCCCCCGGCCCGCCCGG - Intergenic
914112301 1:144715924-144715946 CCCGGTGCCCCCGGCCCGCCCGG + Intergenic
914197339 1:145454430-145454452 CCCGCCGGCCCCGCCGCCCCGGG + Intergenic
914666975 1:149840425-149840447 CCCGGCCCCCCCGCCACGCAGGG + Exonic
914668792 1:149853365-149853387 CCCGGCCCCCCCGCCACGCAGGG - Exonic
914803104 1:150974579-150974601 CCCGGCGCCCGAGCCCCGCGCGG - Intronic
915073682 1:153292468-153292490 CCCAGCACCCCCGCAGCCCTGGG + Intergenic
915359414 1:155277352-155277374 CCCGGCGTCCCAGCCCCGCCCGG + Intronic
920528609 1:206685655-206685677 CCCGCCGCCCGCGCCGCACTCGG - Intronic
921089605 1:211830523-211830545 CCCGGCTCCGCTGCCGCTCTGGG + Intronic
923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG + Intergenic
924289722 1:242524714-242524736 CCCGCCGCCGCCGCCGCCCCGGG - Intergenic
1062774714 10:135517-135539 ACCGCCGCCGCCGCCGCGCCCGG - Intronic
1063636622 10:7788382-7788404 CCCGGCGCCTCCGACGGGCCAGG - Intronic
1064208970 10:13347775-13347797 GCCGCCGCCGCCGCCGCGCGGGG - Intronic
1064553024 10:16521325-16521347 CCCGGCCCCCACCCCGGGCTCGG - Exonic
1065188913 10:23193201-23193223 GCCCGCGCCACCGCCGCGCAAGG - Exonic
1065390076 10:25174574-25174596 TCCCGCGCCCCCGCCGCCCGCGG + Intergenic
1066023082 10:31320830-31320852 CCCTGCGCTCCCGCCGCCCCCGG - Intronic
1067346861 10:45443654-45443676 CCCGGCGCCCACCCCGTGCCCGG - Intronic
1069705733 10:70458329-70458351 CCCGCCCGCCCCGCCGCGCCTGG + Intergenic
1072673133 10:97446255-97446277 CTCGGCGCCCCGGCCGGGCCCGG - Exonic
1073216821 10:101841029-101841051 CCCAGCGGCCCCGCCGGGCTGGG + Intronic
1074182899 10:111078805-111078827 CCCCGGGCCCGCGCTGCGCTCGG - Exonic
1075144618 10:119872634-119872656 GCCGGCCGCCCGGCCGCGCTCGG - Exonic
1075699760 10:124461794-124461816 GCCGGCGCCGCGGCCGCGCAGGG - Intergenic
1076554208 10:131311518-131311540 GCCGCCGCCGCCGCCGCCCTGGG - Exonic
1076837891 10:133030237-133030259 CCCGGCGCCTCCCCCGTGGTGGG - Intergenic
1077052906 11:575848-575870 CCAGGTGCTCCCGCCGCGCGCGG + Intergenic
1077090755 11:777271-777293 CCCGGCGCCCCCAGCGGCCTCGG + Intronic
1077121466 11:910855-910877 CCGCGCGCCGCCGCCGCGCACGG + Intronic
1077253902 11:1572241-1572263 GCCGGCTCGGCCGCCGCGCTCGG + Intergenic
1077404626 11:2377532-2377554 CCCGCCGCCCGCGCCGCCATGGG + Exonic
1078057407 11:8019254-8019276 CCCAGCGCCGCCGCCGCCCGCGG + Intronic
1081492582 11:43579621-43579643 CCCGCCGCCGCCGCGGCGCGGGG - Intronic
1081528506 11:43942835-43942857 CCCGGCGCAGCGGCCGCCCTCGG + Exonic
1081968889 11:47185420-47185442 CCCGGTGCGCCCGCAGCTCTAGG + Intronic
1083617963 11:64035774-64035796 CCCGCCGCCGCCGCCGCGAGGGG + Intronic
1084000178 11:66291858-66291880 GCCGCCGCTGCCGCCGCGCTCGG + Exonic
1084118812 11:67057042-67057064 CCCCGCGCCTCCGCCTCGCCCGG + Intronic
1084310355 11:68312959-68312981 CCCGGCGTCCCCGCCACGCGCGG + Intronic
1084336348 11:68460279-68460301 CCCGCCGCCCCCGCCCCGCCCGG + Intergenic
1086455346 11:86955042-86955064 CCGGGCGCCCCCGGGACGCTCGG + Exonic
1088172964 11:107018271-107018293 CCCGGCGCCGCCGCCGAGCCCGG - Exonic
1089127799 11:116189610-116189632 CCCGGCAGCCCCGCCATGCTGGG - Intergenic
1091550308 12:1531037-1531059 CCCGGCCCCGCGGCCGCGCTGGG + Intronic
1092487448 12:8914676-8914698 CTCGGCGCCCCCGCCCCTCCAGG + Exonic
1094041521 12:26125136-26125158 CCCGACGCCCCCGCCCGGCCCGG - Intronic
1094624037 12:32106523-32106545 CCGGGCGCCCACGCCGCTCTCGG + Intergenic
1094753560 12:33440049-33440071 CCCGGCGCCCCTGCCGAGGCCGG + Intergenic
1096116816 12:49059967-49059989 CCGGCCGCCCGCGCCGGGCTCGG + Intergenic
1096771768 12:53939737-53939759 CCCGGCGCGCCCGCTCGGCTGGG + Intronic
1096946724 12:55414965-55414987 CTCGGCGCCCCCGCCCCTCCAGG - Intergenic
1100423411 12:94459803-94459825 ACCGCCGCCGCCGCCGCCCTCGG - Exonic
1100963101 12:99984842-99984864 CTCGCCGCCGCCGCCGCCCTCGG - Intergenic
1102101326 12:110281152-110281174 CGCGCCGCCCGCGCCGCGCTGGG + Intronic
1102150984 12:110689079-110689101 CCCGGCGCCCCACCCGCCCGCGG + Intronic
1102501881 12:113358726-113358748 CCCAGCGGCCCCCCGGCGCTGGG - Exonic
1103764650 12:123271621-123271643 CCCGGCGCGCCCGCCGCCCGGGG - Exonic
1103775674 12:123364850-123364872 CCCAGCCCCCCCGCCCCGCCGGG + Intergenic
1103856226 12:123972833-123972855 CCCGCCGCCCCCGCCCAGCCCGG - Intronic
1103856286 12:123973009-123973031 CCCCGCGCCCCCCCCTCCCTCGG - Intronic
1104021263 12:124993878-124993900 CCCCGCGCCCCCTGCGCGCCCGG - Exonic
1104901097 12:132189888-132189910 CCCGGCGCCTCCCCCGGCCTCGG + Intergenic
1104929419 12:132329904-132329926 CCCGGAGGCCCCGCTGCCCTCGG - Intergenic
1107058565 13:36131474-36131496 CCCGTCGCCCCCGCCCTTCTTGG + Intergenic
1107604030 13:42040813-42040835 CCCGCCGCCGCCGCTGCGCCGGG - Intronic
1107771007 13:43787302-43787324 CCCGCCACCGCCGCCGCGGTCGG + Intergenic
1110318199 13:74134286-74134308 CCCGCCGCCGCCCCCGCCCTCGG - Intergenic
1110630109 13:77697883-77697905 CCCGGCGGCCGCGGCGCCCTCGG + Intronic
1111672723 13:91348893-91348915 CGCGGAGCCCCCGCCCCTCTGGG + Intergenic
1111672749 13:91348958-91348980 GCCCGCGTCCCCGCCGCACTCGG + Intergenic
1112503454 13:99959035-99959057 GCCGGCCCCTCGGCCGCGCTCGG - Intergenic
1112505081 13:99970583-99970605 CCCGGCGCCGCCGCCGCCGCCGG - Exonic
1112580670 13:100674480-100674502 CGCGCCCCGCCCGCCGCGCTCGG - Intronic
1112771454 13:102799090-102799112 CCCGGCGCCCCGGGCTCCCTGGG + Exonic
1113517758 13:110915693-110915715 CCCGGGGCCTCCGGCGCGGTGGG + Intergenic
1115120061 14:29927861-29927883 CCCGGCCCCCGCCCGGCGCTCGG - Intronic
1115761730 14:36582884-36582906 CCCGGCGCTCCCGCGGGGCCTGG - Intergenic
1116849526 14:49893719-49893741 CCCGGCTCCTCCGACGCGATGGG + Exonic
1117545888 14:56794686-56794708 CCCGGCGGCCCCGCCACGTGCGG + Intergenic
1117803161 14:59465144-59465166 TCCGGCGCCCCCTCCGCGGCCGG - Exonic
1122399233 14:101457704-101457726 CCCGGTGTCCCCGACGCGCCTGG + Intergenic
1122739916 14:103866327-103866349 CCCGCAGCCCCCGCCCAGCTGGG - Intergenic
1122904552 14:104795769-104795791 CCCCGCGCCCGCCCCGCGCCCGG + Intergenic
1122985300 14:105209024-105209046 CCCGGTGCCCACACTGCGCTGGG + Intergenic
1124469236 15:29968626-29968648 CGCGGAGCCCCAGCCGGGCTAGG - Intronic
1124469323 15:29968971-29968993 CCCGCCGCCGCCGCCGTGCGTGG + Intergenic
1124652383 15:31483550-31483572 CCCGCCGTCCCCGCCGCGCCCGG + Exonic
1126109481 15:45167145-45167167 CCCGCCGCCCCCGCCCCGGCTGG - Intergenic
1129162115 15:73752851-73752873 CCGGGGGCCCCGGCCGGGCTGGG + Intergenic
1129483163 15:75843605-75843627 CCCGGCTCCCCTTCCGCGCCCGG + Exonic
1129862395 15:78872789-78872811 CCCTGCGCCCGCGCCGCCCCAGG - Intronic
1129919893 15:79311190-79311212 CGCTGCGCCCCCGGCGGGCTGGG - Exonic
1130362988 15:83207774-83207796 CCCGGCGCTCGCGCCGCGCCCGG - Exonic
1131060155 15:89399707-89399729 CCCGCCGCCCTCGCTGCGCGGGG - Intergenic
1132365082 15:101251430-101251452 CCAGGCGCGCCGGCCGCGCGCGG + Exonic
1132480951 16:165889-165911 CCCCGCGTTCCCGCCGCGCTCGG + Intronic
1132656571 16:1044053-1044075 ACCGGCGCCCCCGCCGCCGCCGG - Intergenic
1132719708 16:1309706-1309728 GCCGCCGCCGCCGCCCCGCTCGG + Intronic
1132730063 16:1356745-1356767 CCCGGCGCCCACGCCCCTCCTGG + Intronic
1132889544 16:2196912-2196934 CCCCGCGCCGCCGCCGCGTCGGG - Intergenic
1133924066 16:10180323-10180345 CCCTTCTCCGCCGCCGCGCTCGG + Exonic
1134644974 16:15858367-15858389 CCCGCCGCTCCCGCCGCTCCCGG - Intergenic
1136540222 16:30924379-30924401 CCCGGCCCCCCCGCCGCCGATGG + Intronic
1138273837 16:55716605-55716627 CCCCCCGCCCCCGCCCCGCCAGG - Intergenic
1138360747 16:56425437-56425459 GCCGCCGCCGCCGCCGCGCCGGG + Exonic
1139203657 16:65004776-65004798 GCAGGTGCCCCCGCCGCTCTGGG + Exonic
1141972499 16:87492902-87492924 GTCGCCGCCGCCGCCGCGCTCGG - Intergenic
1142114660 16:88350382-88350404 CCCGGCGCACCCACCTCCCTTGG + Intergenic
1142136954 16:88455884-88455906 CCCGGCGCCCCCAGCCCGCTGGG + Intronic
1142762423 17:2050234-2050256 CCGGCCGCCGCCGCCGCGCCCGG - Intergenic
1143016354 17:3893015-3893037 CCCCGCCCCACCGCCTCGCTGGG + Exonic
1143537335 17:7549171-7549193 CCCGGCGCCCCCTCCGCCTCTGG - Exonic
1143562737 17:7705232-7705254 GCCGGAGCCCCAGCCTCGCTGGG - Exonic
1143750095 17:9021626-9021648 CCCGCCGCTCCCGCCGAGCTCGG - Intronic
1144656939 17:17042776-17042798 CCTGGCGCTCCCGGCGGGCTAGG - Exonic
1146022638 17:29292912-29292934 GCCGGCGCCCCCGCAGTGCAGGG + Intronic
1146058654 17:29593410-29593432 CCCGCCGCCGCCGCCTCGCGAGG + Intronic
1146759115 17:35460670-35460692 GCCCCCGCCCCCGCCCCGCTGGG + Intergenic
1146955977 17:36936595-36936617 CCCGCCGTCCGCGCCGCGCGGGG + Intergenic
1147162980 17:38578703-38578725 CCCGCCGCCCCCGCCCCCCAGGG + Exonic
1147315491 17:39618177-39618199 CCCGGAGCCCCCGCCCCGCCCGG - Intergenic
1147341387 17:39754858-39754880 CCCGCCGCCCACGCCGCTCGGGG - Intergenic
1147971138 17:44219571-44219593 CCCAGCGCCGCCGCCTCGCCCGG - Intronic
1147996574 17:44363182-44363204 GCCGGCGCCCCCACCCCGCCAGG + Intronic
1148048681 17:44758990-44759012 CCCGGCCCCGCCGCCCCGCCGGG + Intergenic
1148323619 17:46771452-46771474 CCCGGGCCCCGGGCCGCGCTGGG + Intronic
1148685163 17:49496763-49496785 CCGGGCGCCCCCGTCTCGTTAGG - Intronic
1150168365 17:62966224-62966246 GCTAGCGCCGCCGCCGCGCTGGG - Intergenic
1150764734 17:67993921-67993943 CCCGGTGTCTCCTCCGCGCTCGG + Intergenic
1151765290 17:76130627-76130649 CCCGGGGCCCCTGCCCCTCTCGG + Intergenic
1151938868 17:77280941-77280963 CCCGGCGCCGCCGCGGTGCCCGG + Intronic
1151938873 17:77280959-77280981 CCCGGCGCCGCCGCCTCGCCCGG + Intronic
1151938880 17:77280972-77280994 CCGGGCGGCCCCGCCGGGCGAGG - Intronic
1152222162 17:79074882-79074904 GCCCGCCCCCGCGCCGCGCTCGG - Intergenic
1152235348 17:79135593-79135615 CCCGATGCCCCCACTGCGCTGGG - Intronic
1152520864 17:80855849-80855871 CCCTGCTCCTCCGCAGCGCTGGG - Intronic
1152641708 17:81452113-81452135 CCAGGCCCCCCCGCCACGCCAGG - Intronic
1152808879 17:82371896-82371918 CCTCGCGCCCCCTCTGCGCTGGG + Intergenic
1152808891 17:82371944-82371966 CCCCGCGGCCCCGCTGCGCGAGG + Intergenic
1152834221 17:82519354-82519376 CCCGGCGTCCACGCCGGGTTGGG + Intergenic
1153457564 18:5296399-5296421 CCCGGCGCCGGCGCAGCGCCGGG + Intronic
1153488979 18:5629335-5629357 CCCTGCGGCTCCGCCGGGCTGGG + Intronic
1153911250 18:9708248-9708270 GCCGCCGGCCCCGCCGCGGTGGG - Exonic
1155519805 18:26656796-26656818 CTGGGCGCCCCCGCGGCGCTGGG + Intronic
1156448496 18:37253740-37253762 CCCCGCGCCCCGGCCGCCCCCGG + Intronic
1157279120 18:46334245-46334267 GCCGCCGCCGCCGCCGCGCGAGG + Exonic
1157384293 18:47248298-47248320 GCCGCCGCCACCGCCGCCCTTGG - Intronic
1158435948 18:57435679-57435701 CCCGCCGCCCCCGCCGCCCCCGG + Exonic
1159021231 18:63144871-63144893 ACCCCCGCCCCCGCCGCCCTGGG + Intronic
1160025062 18:75209650-75209672 CCCGCCGCCCGGGCCGCGCTCGG - Intergenic
1160040464 18:75340339-75340361 CCCAGTGCCACCGCCGCGCCAGG + Intergenic
1160631026 18:80246761-80246783 CCCGGCGTCCCCCACCCGCTCGG - Intronic
1160822223 19:1063962-1063984 CCTGGCGCCCTCGCCCCACTAGG - Intronic
1160866218 19:1257311-1257333 CTCGGAGTCCCCGCCGCCCTGGG - Exonic
1160909219 19:1467206-1467228 CCCGGCGCCCCCGCCGCGCTCGG - Exonic
1160935461 19:1592586-1592608 CCCGGCGCTCCCGCAGGGCTGGG - Exonic
1161108716 19:2456658-2456680 CCCGGCGCCCACCTCGCGCGTGG + Exonic
1161241106 19:3224556-3224578 CCTGGCGGCCGCGCCGCGCGGGG - Intergenic
1161450633 19:4343611-4343633 CCCCGCGCCTCCGCCCCGCTGGG - Intronic
1161612479 19:5250928-5250950 CCCGCCGCCCCCGCACCCCTTGG - Intronic
1162100324 19:8335035-8335057 CCTGGCACGGCCGCCGCGCTCGG + Exonic
1162524144 19:11197643-11197665 CCGGGCGCCCCGGCCGCGGTGGG + Intronic
1162527843 19:11216991-11217013 GCCGGCGCTCCTGCAGCGCTGGG - Exonic
1162731748 19:12722379-12722401 CCCGACGCCCGGGCCGCGCGCGG + Intronic
1162770389 19:12945918-12945940 CCCGGGGCCGCCGCGTCGCTCGG + Exonic
1162959464 19:14117543-14117565 CCGGCCGCCGCCGCCGCGATGGG - Exonic
1163743891 19:19033488-19033510 CCCGCCGCCGCCGCCGCGCGAGG + Intronic
1164146933 19:22518119-22518141 CCCAGCGGCCCGGCCGCTCTTGG - Intronic
1165696918 19:37907467-37907489 CCCGGCGCCGCCGCCCCCCACGG - Intronic
1166121630 19:40690491-40690513 CCGGGCGCCCCCGCCTCCCGCGG + Exonic
1166780611 19:45340755-45340777 CCCGCCGCTCCCGCTGCGCCGGG - Exonic
1167072326 19:47228214-47228236 CCCGCCGTCACCGCCGCCCTGGG - Exonic
1167154526 19:47730091-47730113 CCTGGTGCCCCCGCCGGGCTGGG + Intronic
1167268252 19:48493884-48493906 CGCGGCCCCGCCGCCGCGCCCGG + Exonic
1167741504 19:51327103-51327125 ACCAGCGCCCGCACCGCGCTGGG + Exonic
1167753313 19:51394239-51394261 CCCCGTGCCCCTGCGGCGCTAGG + Intergenic
1167862541 19:52297127-52297149 GCCCCCGCCCCCGCCCCGCTCGG + Intergenic
1168315268 19:55482235-55482257 CCCGCCGCCGCCCCCGCGCCTGG + Exonic
1168544730 19:57240853-57240875 GCCGCAGCCCCCGCCCCGCTAGG + Intronic
1202710974 1_KI270714v1_random:19205-19227 CCCAGCGCCGCCGCCGCCCACGG - Intergenic
925169986 2:1744429-1744451 CCCGGGGCCCCTGGAGCGCTTGG + Exonic
925725143 2:6865090-6865112 CCCGGAGCCCCCGCTGCACCCGG - Exonic
927713928 2:25341172-25341194 CCCGGGTCCCCCGCCCCGCGGGG + Intronic
927904882 2:26848873-26848895 CTCGGCGCCCGCTCCGGGCTGGG - Intronic
928093769 2:28392165-28392187 CCCGGGGCGCCCGCTGCACTCGG + Intergenic
929107191 2:38376960-38376982 CCCCGCGCTCCCGCAGCGCGCGG - Intronic
930046234 2:47175777-47175799 CCCGGAGCCGCCGCCCCGCTCGG - Intronic
930872609 2:56184134-56184156 CCCGGCGCGCCCTCCAAGCTAGG + Exonic
932331487 2:70900638-70900660 CGCGGGGCCCCGGTCGCGCTCGG - Exonic
932621900 2:73269634-73269656 CCCGCCGCCCCCGCGGCACGCGG + Exonic
936122680 2:109760387-109760409 GCCGCCGCCCCCGCCCCGCCTGG - Intergenic
936222013 2:110611086-110611108 GCCGCCGCCCCCGCCCCGCCTGG + Intergenic
936389009 2:112055208-112055230 CCCGGCCCCGCCTCCGCGCTCGG + Exonic
936433181 2:112482008-112482030 CCCTGCGCCGCCGCCGCCCCCGG + Intergenic
940640868 2:156342761-156342783 CCCGGGGCCCCGGCAGCACTCGG - Intergenic
940775152 2:157876560-157876582 CGCGCCGCCCCCGGCGCGCCTGG + Intergenic
942046553 2:172102431-172102453 GCCGGCGCCGCCGCCGCTCGGGG + Exonic
942150982 2:173075934-173075956 CCCGCCGCCCTCGTCGCGCGCGG + Intronic
942890367 2:180980635-180980657 CCCGCCGCCGCCGCCCGGCTCGG - Exonic
944933780 2:204545970-204545992 CCCGGCGACCACGCCGGGCCGGG - Intronic
945225874 2:207530479-207530501 CCCGCCGCCGCCGCCGGGCCGGG + Intronic
945251363 2:207768670-207768692 CCCGGCCCACCAGCTGCGCTAGG + Exonic
946235718 2:218323366-218323388 CGCGGAGGCCCCGCCGCGCTCGG - Intronic
946301667 2:218827951-218827973 CCCTCCGCCCCCGCCCCTCTGGG + Intronic
946358810 2:219206800-219206822 CCCGGCGCCCGCTCCTCCCTCGG - Exonic
946397038 2:219448418-219448440 GCCGGCGCCCCTGCGGCCCTGGG + Exonic
947518748 2:230828504-230828526 CCCGGGCCCGCCGCGGCGCTGGG - Intergenic
948603170 2:239118997-239119019 CCCGGCGCCCCTGCTGCACCTGG - Intronic
948645225 2:239400435-239400457 CCCCGCGCCCCCGCCCCGGCGGG + Exonic
948824699 2:240568542-240568564 CCCGGCGCGGCCGCCGCCCATGG + Intronic
1169214713 20:3786484-3786506 CCCGGCGCGCCCCCCGCCCCGGG + Exonic
1170889799 20:20367860-20367882 CCCGGCGCCGCCGCCCCGCCCGG - Intergenic
1170889918 20:20368216-20368238 CTCGGTCCCCCCTCCGCGCTCGG - Exonic
1171217224 20:23361547-23361569 CGCGGTGCCCCCGCCCTGCTGGG - Intergenic
1172118519 20:32584894-32584916 CCCGCCGCGCCCGGCGCCCTCGG + Intronic
1172587158 20:36092844-36092866 CCCGGGGACCCCGCCGCGTCGGG + Intronic
1172841009 20:37902907-37902929 CCCGGCCCCGCCTCCGCACTCGG + Intergenic
1173222576 20:41141745-41141767 CCAGGCCCCCCCGCCCAGCTGGG + Intronic
1174380713 20:50153736-50153758 GCCCGCGCCGCCGCCGCGCCCGG - Intergenic
1175108278 20:56629423-56629445 GCCGCCGCCCCCGCCGCGCGCGG - Exonic
1175399541 20:58692759-58692781 CCCGCCTCCCCCGCCGCTCCGGG - Exonic
1176381048 21:6112019-6112041 ACCAGCGCCCCCGCCGCCCGCGG - Intronic
1176549600 21:8215349-8215371 CCCGTCTCGCCCGCCGCGCCGGG + Intergenic
1176557491 21:8259578-8259600 CCCGTCTCGCCCGCCGCGCCGGG + Intergenic
1176566746 21:8392041-8392063 GCCGGCGCGCCCGCCCCGCCCGG - Intergenic
1176568525 21:8398383-8398405 CCCGTCTCGCCCGCCGCGCCGGG + Intergenic
1176576436 21:8442612-8442634 CCCGTCTCGCCCGCCGCGCCGGG + Intergenic
1179674988 21:42974966-42974988 GGCGCCGCCGCCGCCGCGCTGGG + Intronic
1179675020 21:42975067-42975089 CCCGCCGCCCCGCCCGCGCCGGG - Intronic
1179742424 21:43426221-43426243 ACCAGCGCCCCCGCCGCCCGCGG + Intronic
1179810097 21:43864953-43864975 CCCGGCCCCGCCGGCGCCCTCGG + Intergenic
1179923730 21:44521443-44521465 CCCGGCCCCCACGCTGCCCTGGG + Intronic
1180259752 21:46661398-46661420 CCCCGCGCCCCCGCCCTGCCTGG + Intronic
1180748991 22:18111406-18111428 CCGGAGGACCCCGCCGCGCTGGG - Intronic
1181299153 22:21867276-21867298 CCCGGCCCCCCCACCGCCCGGGG - Intronic
1183692890 22:39400889-39400911 ACAGGCGCCCCCACCACGCTCGG - Intronic
1183702168 22:39457111-39457133 CCGGGCTCCGCCGCCGCGCCGGG - Intergenic
1184676229 22:46044902-46044924 CCCGCTGCCCCAGCCGCGCCCGG + Intergenic
1184766969 22:46577174-46577196 CCCGGCTCCCCGGCGCCGCTGGG + Intronic
1185037935 22:48489464-48489486 GCCGCCGCCGCCGCCGCGCCCGG - Exonic
1185336021 22:50271174-50271196 CTCGGCGTCTCTGCCGCGCTCGG + Intergenic
1203254486 22_KI270733v1_random:131670-131692 CCCGTCTCGCCCGCCGCGCCGGG + Intergenic
1203262542 22_KI270733v1_random:176749-176771 CCCGTCTCGCCCGCCGCGCCGGG + Intergenic
952430554 3:33219049-33219071 CCCGGCTCCGCCTTCGCGCTGGG + Exonic
952942648 3:38455411-38455433 CGCGGGTCCCCCGCCGCCCTCGG + Intronic
953627252 3:44581065-44581087 CCTGGCGCTCCCGGCGGGCTAGG + Intronic
953947771 3:47164007-47164029 GCCGCCGCCGCCGCCGCGGTCGG - Intergenic
954613476 3:51958135-51958157 CCCAGGGCCGCCGCCGGGCTTGG - Exonic
954717467 3:52533753-52533775 CCCGCCGCCCGCGCTGCCCTCGG + Exonic
955195594 3:56802148-56802170 CCGGGCGCCCCCGCAGAGCGTGG + Intronic
956678250 3:71754581-71754603 GACGGCGCCCCCGGCGCGCTGGG + Exonic
958942928 3:100334894-100334916 CCCCGCGTCCCCGCCGTGCGCGG + Intronic
961688219 3:128650333-128650355 CCCGGCGCCTCCGCTGCCCCCGG - Intronic
961740009 3:129027321-129027343 CCCGGCGCCCGTGCCCCGTTTGG + Intronic
961831837 3:129626995-129627017 CCCCGTGCCCCCGCCCCCCTAGG - Intergenic
962751004 3:138434823-138434845 CCCGGGGCCCCCAGCGCCCTGGG + Exonic
963253023 3:143119783-143119805 CCGGGCGCCCGCAACGCGCTCGG - Exonic
963927778 3:150969466-150969488 ACAGGCGCCCCCGCCACGCCCGG + Intronic
964201224 3:154121392-154121414 GCCGGCGCCGGCGCCGCGGTCGG + Intronic
966362875 3:179148673-179148695 CCGGGCGCGCCCGCCGTGTTGGG + Intronic
967271644 3:187737980-187738002 CCCAGCGGCCCCGCCTCCCTGGG - Intronic
967849549 3:194071414-194071436 CCCTCCGCCCCCGCCGGGCGTGG - Intergenic
968035332 3:195543435-195543457 CCCCGCCCCCGCGCGGCGCTGGG + Intergenic
968506478 4:973442-973464 CCCGGGGCCCGCGCCTGGCTGGG - Exonic
968659640 4:1793710-1793732 CCCGCCGCCGCCGCCGCCCAGGG - Intronic
970394713 4:15654887-15654909 GCCGGCCCCACCGCCGCGCTGGG - Intronic
970456109 4:16226185-16226207 CAAGGCGCCCCCGCCGCCCTCGG + Intronic
971406014 4:26321180-26321202 CACGCCGCCGCCGCCGCGCTCGG - Intronic
972312200 4:37891537-37891559 CCCCCCACCCCCGCCGCCCTTGG + Intronic
972725867 4:41746078-41746100 CCCGGAGCTCCAGCCGGGCTGGG + Exonic
977257727 4:94758521-94758543 CCCTGGGCCCCCGCCCCGCCGGG - Intronic
978385536 4:108172722-108172744 CCCTGCGTCCCTGCCTCGCTGGG + Intergenic
980930259 4:139177358-139177380 CCCCGCCCCCCCGCCGCGTGGGG - Intergenic
982157215 4:152535275-152535297 CCCCCCGGCCCCGCCGCCCTCGG + Exonic
982573211 4:157076161-157076183 GCCCGCGCCACCGCCGAGCTCGG - Exonic
984734945 4:183099674-183099696 CCCGGAGACCCGGCCGCGCGGGG + Intronic
984801804 4:183722991-183723013 CCCAGGGCGCCCGCCTCGCTCGG - Intergenic
985544415 5:501935-501957 CCCGGGGGCCCGGCCTCGCTCGG - Intronic
986858897 5:11904061-11904083 CCCGGCGGCCCCTCCGAGCTCGG + Intergenic
988595299 5:32585520-32585542 GACGCCGGCCCCGCCGCGCTGGG - Exonic
989102532 5:37835776-37835798 CCCCGCGCCCCCGTCACGCCTGG + Exonic
992444103 5:76819192-76819214 CCCAGCAGCCACGCCGCGCTGGG - Exonic
992563242 5:77972898-77972920 CCCGGGGGCCGCGCCGCGCCGGG - Intergenic
993898773 5:93570756-93570778 CCGGGCCCCTCCGCCGCGCGGGG + Intergenic
994171404 5:96662603-96662625 CCCGGCGCCCCCGCGGGGCAGGG + Intronic
997551648 5:134758620-134758642 CCCGGCGCCCGCACCACGCCCGG - Intergenic
997560969 5:134846016-134846038 CCCGCCGCGGCCGCCGCGCACGG - Exonic
998095648 5:139394402-139394424 CGCGGCGCGCCGGCCGCCCTTGG + Exonic
998458306 5:142290752-142290774 CCCCCCGCCCCCGCCAAGCTGGG + Intergenic
999169506 5:149581509-149581531 CCCGGCACCCGCGCCGCTCCGGG - Exonic
999248293 5:150167038-150167060 CCCCGCGCCCCCGACGGCCTGGG + Exonic
1000305025 5:159987079-159987101 CCCGGCTCCCCCGCCGCTGGGGG - Intergenic
1001381637 5:171309884-171309906 GCCGAGGCCTCCGCCGCGCTTGG - Intronic
1002029320 5:176416379-176416401 GCCGGAGCCTCCGCTGCGCTCGG + Exonic
1002296291 5:178232905-178232927 CCCGGCGCCCAGGCGGGGCTCGG + Intergenic
1002352137 5:178590462-178590484 CCCCGCCCCCTCGCCGCGCGGGG - Exonic
1003074454 6:2971310-2971332 GCCCGGGCCCCCGCCCCGCTGGG + Intronic
1003175606 6:3750960-3750982 CCGGGCGCCCCCGCCCTCCTCGG + Intronic
1003840384 6:10113399-10113421 CCCGGCGCCCCCGCTGGGCCAGG - Intronic
1003901581 6:10659985-10660007 CCGGGCGACCCCGCCGGCCTTGG + Intergenic
1004044690 6:12012449-12012471 GCCGCCGCCGCCGCCGCGCGGGG + Exonic
1004396339 6:15248819-15248841 CCCCGCCGCCCCGCCGCGCCTGG - Intronic
1006337435 6:33427991-33428013 GCCGCCGCCCCCACCGCGCCGGG + Intronic
1006458295 6:34144270-34144292 CCCGGCCCCGCCCCCGCGCGGGG + Intronic
1007363725 6:41375674-41375696 CCCGGCTCCCGCTCCGGGCTGGG - Intergenic
1007557902 6:42782435-42782457 CCCGGGGCCCCGGCAGCGCTGGG - Intronic
1008673235 6:53794595-53794617 CCTGGCGCCCCCGGCGCGCAAGG + Intronic
1010428168 6:75749152-75749174 CCCGGCGCCCCCGCCCCTTCGGG + Intergenic
1011228826 6:85137345-85137367 CCCCCCTCCCCCGCCGCGATAGG - Intergenic
1014137711 6:117907818-117907840 CCCGCCGCCGCCGCTGCCCTCGG - Exonic
1017810743 6:157981833-157981855 GCCGCCGCTCCCGCCGCGCCAGG - Intergenic
1018134661 6:160767526-160767548 CCGGGCGCCCTCGCCTCCCTGGG - Intergenic
1018613162 6:165662549-165662571 CCCGGCGCCCTCTCTGCGCGCGG - Intronic
1019048911 6:169168428-169168450 CCTGGCGCCGCCGCCGCCCTGGG - Intergenic
1019343756 7:519998-520020 CCGGGCGCCGCCGCCGCGGCAGG + Intronic
1019562631 7:1666078-1666100 GCCGCCGCCGCCGCCGCGCTCGG + Intergenic
1020105700 7:5421339-5421361 CGCGGAGCCCCCGCCGCCCGAGG - Exonic
1020274286 7:6615482-6615504 GCCGTCGCCGCCGCCGCTCTAGG - Intergenic
1021231102 7:18086898-18086920 GCCGCCGCCGCCGCCGCGCGGGG - Intergenic
1021486084 7:21169856-21169878 CCCGGAGCCCCGGCCTGGCTCGG + Intergenic
1022103867 7:27184834-27184856 CCAGGCACGCCGGCCGCGCTGGG + Exonic
1022546413 7:31193253-31193275 CCGGCTGTCCCCGCCGCGCTGGG + Intergenic
1023881790 7:44325114-44325136 CCCGGCCCGGCAGCCGCGCTGGG + Intronic
1024499821 7:50093152-50093174 GCCGCCTGCCCCGCCGCGCTGGG + Exonic
1025777169 7:64569746-64569768 ACCAGCGCCCGCACCGCGCTGGG - Intergenic
1026004694 7:66591769-66591791 CCCGGCGCCCCTGCCGCGGCCGG + Intergenic
1026025597 7:66741253-66741275 CCCCGCGCCCCTGCCGCGGCCGG - Intronic
1026840606 7:73668272-73668294 CCCGGCGCCCCACCCGCCCCAGG - Intronic
1027001810 7:74658733-74658755 CCCGGCGCGCCTGCCCCGCGGGG + Intronic
1029424872 7:100489018-100489040 GCCGGCGCCCCCGCCGCCTTAGG - Exonic
1031484407 7:122310598-122310620 CCGGGCGCCGCTGCCGGGCTGGG + Intronic
1032525633 7:132576896-132576918 CCCCGCGCACTCGCCGCGCCCGG - Exonic
1033477164 7:141702114-141702136 CGCGGCGCCGCTGCTGCGCTGGG - Exonic
1034192709 7:149224046-149224068 CCCATCGCCCCCGCCGCCCCCGG - Exonic
1034781841 7:153888130-153888152 CCTGGCGCCCGCGCCGGCCTCGG + Intronic
1035573129 8:687525-687547 CCCTGCGCCCCCTCAGCGCGTGG - Intronic
1036664798 8:10731129-10731151 CTCGACGCCCCCGCCGCCCCTGG + Intronic
1037512959 8:19602499-19602521 CACAGCGCCCCAGCCGCGCCTGG + Intronic
1037876462 8:22551304-22551326 CCCCGCCGCCCCTCCGCGCTGGG - Intronic
1037886729 8:22599575-22599597 CCCGCCCCCCCAGCCCCGCTGGG + Intronic
1038429854 8:27491319-27491341 CCCAGCGCCGCCGCCGCAGTGGG + Intronic
1040850675 8:51898606-51898628 CGCGGCGCCCCGGCCTCCCTCGG + Intronic
1041449919 8:57995058-57995080 CCCCGCGCCCCCTCTGCGCTCGG + Intronic
1042307173 8:67343855-67343877 CCCGGCGCCGCGGCAGCTCTGGG - Intergenic
1045047621 8:98294241-98294263 CTCGGCGCGCCCGCCTCGCCCGG - Exonic
1045063764 8:98427947-98427969 CCGGCCGCCCGCGCCGCGCGGGG - Exonic
1049109791 8:140635639-140635661 CCCGCCGCCCCGGCCGCGTCGGG - Intergenic
1049548643 8:143246453-143246475 CCCAGCGGCCCCGCCCCGCAAGG - Intergenic
1050385489 9:5086131-5086153 CCCGGCGGCCCCGCAAGGCTCGG + Intronic
1051855324 9:21559282-21559304 CCCGGAGCGCCGGCCGCCCTTGG - Intergenic
1053503594 9:38621582-38621604 CCCGGCCCGCCCGACCCGCTAGG - Intergenic
1055937852 9:81620124-81620146 CCCGGGCCCCCCGCCTCCCTTGG - Intronic
1057596445 9:96418870-96418892 CCCGCCGCCCGCCCCGCCCTCGG + Intergenic
1059372252 9:113851584-113851606 CCCGGCAGCCCGGCCGCGCCCGG + Intergenic
1060087356 9:120714498-120714520 CCGGTCGCTCCCTCCGCGCTGGG - Intergenic
1060770181 9:126326829-126326851 GCCGCCGCCGCCGCCGCTCTCGG + Exonic
1060952266 9:127612017-127612039 CCCTGCGCCCCGGGCGCGCGCGG + Intergenic
1061212704 9:129203027-129203049 CCCGGCGCCCGCGCGGCTCACGG + Intergenic
1061550411 9:131331347-131331369 CCCTGCGCCCCCTCCCCACTTGG + Intergenic
1062169547 9:135127314-135127336 CCCGGTGCCCCCGCCAGCCTGGG - Intergenic
1062343380 9:136103698-136103720 CCCGCCACCTCCGCCGCCCTGGG - Intergenic
1062435784 9:136546077-136546099 CCCGCCGGCCCCGCCCCGCCCGG + Intergenic
1062493663 9:136821652-136821674 CTCGGGCCTCCCGCCGCGCTGGG + Intronic
1062537773 9:137028375-137028397 CCCGCCGCCCGCGCCGCGCCCGG + Intronic
1062574540 9:137200170-137200192 CCCAGCCCGCCCGCCGCGCCCGG - Exonic
1062574667 9:137200598-137200620 CCCCGCGCCCCCGCCCAGCGCGG + Exonic
1062696343 9:137877995-137878017 CCCGCCGGCCCCGCCGCCCCGGG - Exonic
1203470887 Un_GL000220v1:114814-114836 CCCGTCTCGCCCGCCGCGCCGGG + Intergenic
1203478708 Un_GL000220v1:158786-158808 CCCGTCTCGCCCGCCGCGCCGGG + Intergenic
1193715842 X:84934388-84934410 CCCGACGCCCCCGCCGACCCCGG + Intergenic
1198282528 X:135155894-135155916 CCCGGCACCCCCACCGTCCTCGG - Intergenic
1198288431 X:135216628-135216650 CCCGGCACCCCCACCGTCCTCGG + Intergenic
1198388140 X:136147717-136147739 CCCGCCGCCGCCGCCGCTCGGGG + Intronic
1200098201 X:153673900-153673922 TGCGGCGCCGCGGCCGCGCTGGG - Intronic
1200141678 X:153905689-153905711 CCCGCCGGCCCCGCCGAGCTAGG - Exonic
1200155580 X:153972934-153972956 GCCGCCGCCGCCGCCGCGCCCGG - Intronic
1200217532 X:154374678-154374700 CCCCGCGCCCGCCCCGCGCCCGG + Intergenic
1200233620 X:154458211-154458233 CCGGACGCCCCCGCCCCGCGCGG + Intergenic