ID: 1160909330

View in Genome Browser
Species Human (GRCh38)
Location 19:1467597-1467619
Sequence CACCTCTGCCAGACAGGCCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 266}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160909320_1160909330 9 Left 1160909320 19:1467565-1467587 CCAGCGGGCAGGCAAAGACCCAC 0: 1
1: 0
2: 0
3: 10
4: 88
Right 1160909330 19:1467597-1467619 CACCTCTGCCAGACAGGCCATGG 0: 1
1: 0
2: 5
3: 26
4: 266
1160909322_1160909330 -9 Left 1160909322 19:1467583-1467605 CCCACCGGCCGCCCCACCTCTGC 0: 1
1: 0
2: 1
3: 31
4: 333
Right 1160909330 19:1467597-1467619 CACCTCTGCCAGACAGGCCATGG 0: 1
1: 0
2: 5
3: 26
4: 266
1160909316_1160909330 22 Left 1160909316 19:1467552-1467574 CCAGCCCGGGGGACCAGCGGGCA 0: 1
1: 0
2: 1
3: 15
4: 173
Right 1160909330 19:1467597-1467619 CACCTCTGCCAGACAGGCCATGG 0: 1
1: 0
2: 5
3: 26
4: 266
1160909319_1160909330 17 Left 1160909319 19:1467557-1467579 CCGGGGGACCAGCGGGCAGGCAA 0: 1
1: 0
2: 1
3: 19
4: 168
Right 1160909330 19:1467597-1467619 CACCTCTGCCAGACAGGCCATGG 0: 1
1: 0
2: 5
3: 26
4: 266
1160909312_1160909330 30 Left 1160909312 19:1467544-1467566 CCCAGGGACCAGCCCGGGGGACC 0: 1
1: 0
2: 0
3: 13
4: 201
Right 1160909330 19:1467597-1467619 CACCTCTGCCAGACAGGCCATGG 0: 1
1: 0
2: 5
3: 26
4: 266
1160909313_1160909330 29 Left 1160909313 19:1467545-1467567 CCAGGGACCAGCCCGGGGGACCA 0: 1
1: 1
2: 0
3: 21
4: 274
Right 1160909330 19:1467597-1467619 CACCTCTGCCAGACAGGCCATGG 0: 1
1: 0
2: 5
3: 26
4: 266
1160909323_1160909330 -10 Left 1160909323 19:1467584-1467606 CCACCGGCCGCCCCACCTCTGCC 0: 1
1: 0
2: 4
3: 85
4: 797
Right 1160909330 19:1467597-1467619 CACCTCTGCCAGACAGGCCATGG 0: 1
1: 0
2: 5
3: 26
4: 266
1160909318_1160909330 18 Left 1160909318 19:1467556-1467578 CCCGGGGGACCAGCGGGCAGGCA 0: 1
1: 0
2: 0
3: 16
4: 211
Right 1160909330 19:1467597-1467619 CACCTCTGCCAGACAGGCCATGG 0: 1
1: 0
2: 5
3: 26
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160909330 Original CRISPR CACCTCTGCCAGACAGGCCA TGG Exonic
900506415 1:3031768-3031790 CACTTTTGCCAGCCAGGCCTCGG + Intergenic
900530663 1:3151421-3151443 CACCTTGCCCAGCCAGGCCATGG + Intronic
900626349 1:3610423-3610445 CACCCCTGCCAGCAAGGCCAGGG + Intronic
902277008 1:15347108-15347130 CACCTGTGCCAGAGACGCCAAGG - Intronic
902548397 1:17204969-17204991 CCCATCTCCCAGACAGGCCTTGG + Intergenic
902807213 1:18868618-18868640 CACCTCACCCTGGCAGGCCATGG + Intronic
903192781 1:21666215-21666237 GACCTCTGCCAGGCTGGCCCTGG - Intronic
903953907 1:27012141-27012163 CCCCTCTCCCAGCCAGGCCCTGG + Intronic
904411118 1:30325476-30325498 CACCCCACCCAGCCAGGCCATGG + Intergenic
904475522 1:30762308-30762330 CCCCTCAGCCAGGCAGTCCAGGG + Intergenic
904685328 1:32255688-32255710 CACCTCTGTCACAGAGGGCAGGG + Intronic
905824309 1:41017310-41017332 CAACTCTACCAGACAGACCAGGG - Exonic
906145979 1:43560908-43560930 CACCTATGCCATGCGGGCCAGGG + Intronic
906523077 1:46478735-46478757 CACCCCTCCCAAGCAGGCCATGG + Intergenic
906729407 1:48068444-48068466 GAGCTCTACCATACAGGCCATGG + Intergenic
906946758 1:50301039-50301061 CACCTATGGCAGAAAGGCCAGGG - Intergenic
907719825 1:56961309-56961331 CACCTATGACAGACATGTCAAGG + Intronic
908130224 1:61067958-61067980 CACCACTGCCACACAGACCTGGG - Intronic
909592819 1:77370840-77370862 CATAGCTTCCAGACAGGCCAGGG + Intronic
909618546 1:77640911-77640933 CACCTCTCCCAAACATGCCCTGG + Intronic
912626864 1:111212687-111212709 CACCCCAGCCAGGGAGGCCAGGG - Intronic
912924092 1:113897939-113897961 CACCACTACAATACAGGCCAGGG + Exonic
914716170 1:150257001-150257023 GACCTCCGGCAGAGAGGCCAGGG - Intergenic
915311607 1:155008238-155008260 AACCCCTGCCAACCAGGCCAGGG - Intronic
917219197 1:172709545-172709567 CACACAGGCCAGACAGGCCATGG - Intergenic
920200273 1:204255932-204255954 CACCTCTCCCAGGGAGGCCTAGG - Intronic
920313445 1:205061758-205061780 CACCTGTGCCAGACAGCAGAGGG - Intronic
920867061 1:209761959-209761981 CATTTCTGCCAGTCAGGACAAGG + Intronic
1064374793 10:14785787-14785809 CACCTGAGCCTGAGAGGCCAAGG - Intergenic
1064604263 10:17022203-17022225 GAACTCAGCGAGACAGGCCAAGG - Intronic
1067539057 10:47138400-47138422 CTCCTCTTCCAGAAGGGCCAAGG - Intergenic
1067687573 10:48476366-48476388 CACCTCTGACAGACAGGAGTGGG - Intronic
1067833980 10:49626667-49626689 CACCTCTTCCAGACATGCTCTGG + Intronic
1069630901 10:69896523-69896545 CACCCCTGCCAGGCAGGTCCGGG + Intronic
1070164507 10:73887714-73887736 CACCTGTGCCAGAAAGCCCAAGG + Intergenic
1071173340 10:82894899-82894921 CCCCACTGCCCGACAGGCCCTGG + Intronic
1073084600 10:100880055-100880077 CACCTCTGATAGACACACCAGGG + Intergenic
1075209342 10:120477900-120477922 CATGTCGGCCAGACAAGCCATGG - Intronic
1075758243 10:124833379-124833401 CACCTGAGCCTGACAGGTCAAGG + Intronic
1076425672 10:130365868-130365890 CCCCTCTGCCCGACAGGCCCCGG + Intergenic
1077226975 11:1442820-1442842 CCTCTCTCCCAGGCAGGCCAGGG - Intronic
1077353355 11:2103238-2103260 CTCCTCTGCCAGACTGGCCATGG - Intergenic
1077453589 11:2664999-2665021 CACCTCTGGCTAACAGGCCCCGG - Intronic
1078137229 11:8661619-8661641 CTCCTTTGCCTGACAGTCCAGGG - Intronic
1078522025 11:12071124-12071146 CACTTCTCCCAGACTGGCCTGGG - Intergenic
1080685494 11:34511798-34511820 CTCCTCTGGCAAACTGGCCAAGG - Exonic
1083301184 11:61740323-61740345 CCCTGCTGCCAGGCAGGCCAGGG + Intronic
1083614634 11:64020258-64020280 CACGTCTTCCAGACAGGGAAAGG - Intronic
1083742208 11:64716943-64716965 CGCCTCTCCCACCCAGGCCAAGG + Intronic
1083759361 11:64807272-64807294 CACCTCTGCCCGATAGGCTAAGG - Intronic
1084697897 11:70767179-70767201 CACCTCTGCCTTCCAGCCCAGGG + Intronic
1085434855 11:76491544-76491566 CAGCTCTGACAGCCATGCCAGGG + Intronic
1090204015 11:124875091-124875113 CACCTGTGGGAGACAGGACAAGG - Exonic
1091450917 12:571396-571418 CACGTCTGCCAGGCAGGCCCAGG - Intronic
1091628333 12:2139664-2139686 CTCCTCTGCCACACATGCCACGG - Intronic
1092784962 12:12018378-12018400 CCACTCTGCCAGCCAGGCCCAGG + Intergenic
1092863032 12:12735902-12735924 CACCACTGCCACTCAGGCCTGGG + Intronic
1093041117 12:14380700-14380722 AACCTCTGCCTCCCAGGCCAAGG + Intronic
1094705855 12:32913898-32913920 CACCTGAGCCTGACAGGTCAAGG - Intergenic
1096570987 12:52523034-52523056 CAGCTCTGCGAGAGAGGTCAGGG - Intergenic
1096607933 12:52780120-52780142 CACCTCTGCCACCCTGGCCTAGG + Intergenic
1097074959 12:56386081-56386103 AACCTCTGGCAGACAGCCAAAGG + Intergenic
1098198934 12:68034535-68034557 CACCTCACCCAGATATGCCAAGG + Intergenic
1098334995 12:69394689-69394711 CACCTGAGCCAGAAAGGTCAAGG - Intergenic
1098336557 12:69411211-69411233 CACCTGAGCCAGAGAGGTCAAGG - Intergenic
1101021884 12:100561106-100561128 CACCGCGCCCAGCCAGGCCAGGG - Intronic
1103713510 12:122929852-122929874 CACATCTGCCAGGCAGGCACCGG + Exonic
1104990744 12:132622559-132622581 CCCCACAGCCAGCCAGGCCACGG + Intergenic
1105645453 13:22313046-22313068 CCCCACTGGCAGACAGGCCCTGG + Intergenic
1107559534 13:41547103-41547125 CAGCTCTCCCAGGGAGGCCAAGG - Intergenic
1109290396 13:60467140-60467162 CCCCACTGCCTGACAGGCCCCGG + Intronic
1110878218 13:80537483-80537505 CCCCACCCCCAGACAGGCCACGG + Intergenic
1113307374 13:109093368-109093390 CACCTCTGTCTGACTGGACAGGG - Intronic
1118914839 14:70094145-70094167 CATCTCTGACAGCCAGTCCATGG + Intronic
1119115780 14:72019988-72020010 AACCTCTCCCCGACAGGTCAGGG - Intronic
1122345382 14:101055370-101055392 CACCTCTGCCAGAGAGGCAATGG + Intergenic
1122660749 14:103293394-103293416 CACCTGGGCCAGGGAGGCCAAGG + Intergenic
1122718395 14:103708490-103708512 CACCCCTGGCAGAGATGCCAGGG + Intronic
1122893462 14:104743676-104743698 CAGCTCAGTCAGACAGGCCAAGG + Intronic
1123099358 14:105785811-105785833 CACCTGTGACTGACCGGCCATGG + Intergenic
1123114817 14:105889924-105889946 CACCACTTACACACAGGCCAGGG - Intergenic
1124126054 15:26938981-26939003 CTACTCTGACAGACAGACCAGGG + Intronic
1128245052 15:66127405-66127427 CACCTCAGCCAGGCAGGACCTGG - Intronic
1128252401 15:66172374-66172396 CAGCTCTGCCCACCAGGCCACGG - Intronic
1128261447 15:66235795-66235817 CACCTCTTCCCCACAGGTCAAGG + Intronic
1129233899 15:74212341-74212363 CCCCTCTGCCAGACTTGCCTTGG - Intergenic
1129460300 15:75697074-75697096 CACCTTCCCCAGCCAGGCCAGGG + Intronic
1130284034 15:82540733-82540755 CATCTCTTCCACACACGCCAGGG + Intronic
1130960771 15:88657380-88657402 CACCTCTTCCAGACACGGGAGGG - Intergenic
1131402215 15:92134237-92134259 CAGCTCTGGCAGACAGGGCCAGG - Intronic
1131669578 15:94605675-94605697 CAGCTCTGCCATTCAGGCCTGGG + Intergenic
1132577972 16:672616-672638 CAGATCTGCCAGGCAGGCCTGGG - Intronic
1132634739 16:938224-938246 TCCCTGTGCCAGGCAGGCCATGG - Intronic
1132814920 16:1821130-1821152 CAGCTCAGCCACACAGGACAAGG + Intronic
1132900908 16:2253809-2253831 CCCCTCTGCCAGCCGGGCCCCGG - Exonic
1132915662 16:2341862-2341884 CACCTCTCCCTGCCACGCCAAGG - Intergenic
1133441492 16:5824563-5824585 CACCTCAGCCAGACAGGAGGAGG - Intergenic
1135509325 16:23068702-23068724 CACATCTGCCAAAAAGGCCTCGG - Exonic
1135706850 16:24682616-24682638 CCCCTATGCCTGAAAGGCCAAGG + Intergenic
1136026691 16:27473250-27473272 TACCTCTGCTGGACATGCCATGG + Intronic
1136143305 16:28301073-28301095 CACCACTGGCTGACAGGCAAGGG - Intronic
1137420023 16:48325272-48325294 CACCTCCTCCTGACAGGCCATGG + Intronic
1139650675 16:68360612-68360634 CATCTCTACCAGCCAGCCCAGGG - Exonic
1139936305 16:70573871-70573893 AACCTCTGCCAGTAAGGTCAGGG - Exonic
1139956466 16:70695584-70695606 CACCTCTGCGAGGAAGTCCACGG + Exonic
1141280997 16:82629211-82629233 CACCTGTGCCAGCCTGGCCCTGG - Intronic
1141733249 16:85836100-85836122 CCTCTCTTCCAGAAAGGCCAGGG - Intergenic
1142062282 16:88038247-88038269 CCCCTCTCACATACAGGCCATGG + Intronic
1142408266 16:89903124-89903146 CAGCTCTGCCACAAAGGACAGGG - Intronic
1144444499 17:15314547-15314569 AAACTCTTCCAGACAGGACACGG + Intronic
1145198402 17:20916971-20916993 CACCACAGCCAGCCAGACCAGGG - Intergenic
1147315906 17:39620149-39620171 TTCCTTTCCCAGACAGGCCAAGG + Intergenic
1148763302 17:50020750-50020772 CACCTCTGCCAGCCAGCACCAGG + Intergenic
1148837589 17:50474057-50474079 CTCCTCTGCCAACCAGCCCAGGG + Intronic
1150031035 17:61735715-61735737 CACCTGAGCCCGAGAGGCCAAGG + Intronic
1152812993 17:82391043-82391065 GATCTATGCCAGACAGGCTAAGG + Intronic
1153621058 18:6978250-6978272 CACATCTGCCAGCCTGTCCAGGG - Exonic
1154396279 18:13992779-13992801 CACCTCTGTGAAGCAGGCCAAGG - Intergenic
1155653912 18:28175405-28175427 CACCCCTGCCTCCCAGGCCAGGG - Intronic
1156480572 18:37433965-37433987 AACTTCTGCCACACAGGCCTGGG - Intronic
1160496255 18:79377568-79377590 CACCCCTGCCAGGCAAGCCCAGG + Exonic
1160496270 18:79377633-79377655 CACCCCTGCCAGGCAAGCCCAGG + Exonic
1160496284 18:79377699-79377721 CACCCCTGCCAGGCAAGCCCAGG + Exonic
1160496320 18:79377830-79377852 CACCCCTGCCAGGCAAGCCCAGG + Exonic
1160909330 19:1467597-1467619 CACCTCTGCCAGACAGGCCATGG + Exonic
1160979107 19:1808348-1808370 CCCCTCTGCCAGGCAGCCCGCGG - Intronic
1161089100 19:2351390-2351412 CACCTCAGCCAGGCAGGCCAGGG - Intronic
1161324765 19:3658298-3658320 CATCACTCCCAGCCAGGCCATGG - Intronic
1161592327 19:5134436-5134458 CAGCTCAGCTAGACAGGCCAGGG - Intronic
1164463206 19:28465652-28465674 CAGCTCTGCCAGCAGGGCCAGGG - Intergenic
1164653961 19:29907031-29907053 CCCCACTGCCCGACAGGCCCCGG - Intergenic
1165172619 19:33904883-33904905 CACCTCTGCCAGTCAGTTCTTGG - Intergenic
1166074953 19:40408564-40408586 CTCTGCTGCCAGACAGGCCTCGG - Intronic
1166100815 19:40570506-40570528 CACCTCGGCCGGACCGGCCCCGG + Exonic
1166108925 19:40611174-40611196 CCCCTCGGCCACACAGGCCTGGG - Exonic
1167471755 19:49679574-49679596 CACCTCCCCCATCCAGGCCAGGG - Intronic
1167497504 19:49828261-49828283 CACCAGTCCCAGACAGGACAGGG - Intronic
1167792358 19:51690047-51690069 CTGGGCTGCCAGACAGGCCAGGG + Intergenic
926983970 2:18601121-18601143 CACCTGTGCCTGAAAGGTCAAGG - Intergenic
929436341 2:41931344-41931366 CACCTCTGCCAGAGGAGCCGTGG + Intergenic
931111420 2:59115425-59115447 CACCTGTGCCTGGGAGGCCAAGG - Intergenic
932785973 2:74604184-74604206 CACCTCTGCCTGACAGGCTCTGG + Intronic
936376160 2:111943089-111943111 CACCCCTGCCTATCAGGCCATGG + Intronic
937443155 2:121933984-121934006 ACACTCTGCCAGACAGCCCATGG + Intergenic
938802400 2:134775174-134775196 CACCACAGCATGACAGGCCAGGG + Intergenic
942575126 2:177355275-177355297 CACCTGCGCCTGACAGGTCAGGG - Intronic
943152008 2:184125634-184125656 CCCCACTCCCAGACAGGCCCTGG + Intergenic
947298867 2:228665809-228665831 CACCCCCGACAGACAGGCCCCGG - Intergenic
947726732 2:232406114-232406136 GCCCTCGGCCAGACAGGCCTGGG - Intergenic
948081262 2:235207215-235207237 CACGTCTGCAAGGCTGGCCAAGG - Intergenic
948545911 2:238728609-238728631 CACCGCTGCAAGGCAGGCCCAGG - Intergenic
948976432 2:241466437-241466459 CACCACTGCCAGGCAGGCCGGGG + Intronic
1169120159 20:3090911-3090933 CACTACTGCCAGAGAGGGCATGG + Intergenic
1169440104 20:5626764-5626786 GCCCTCTGCCAGTCAGGTCAGGG - Intergenic
1170517500 20:17147045-17147067 CCCCAATGCCCGACAGGCCATGG - Intergenic
1170614991 20:17941305-17941327 CACCTCTTCCTAACAAGCCATGG + Intergenic
1170787798 20:19482413-19482435 CCCCTCTGCCATGTAGGCCAAGG + Intronic
1170872163 20:20216043-20216065 CACCTTTGCCAGGCAAGCAAAGG - Intronic
1172103149 20:32497778-32497800 CACCCCTGCCAGGCAGCCCAGGG - Intronic
1172574259 20:35995161-35995183 CCCTGCTGTCAGACAGGCCAAGG - Intronic
1172596624 20:36154820-36154842 CTCCTCTGGCAGGCAGGCCGCGG - Exonic
1173802043 20:45899939-45899961 CACCTCTGGCAGGTAGGCCTGGG - Intronic
1174036600 20:47672389-47672411 CACTTCTGAAAGACATGCCAGGG + Exonic
1174051521 20:47770721-47770743 AACAACTGCCAGACAAGCCAAGG - Intronic
1174720976 20:52812286-52812308 AAGCTCTGCCAGACTGGCCCTGG - Intergenic
1175539759 20:59741079-59741101 CACCTTTGTCAGAGAGGACAGGG - Intronic
1175728203 20:61333783-61333805 CAGGTCTCCCAGACAGCCCAGGG - Intronic
1176146464 20:63567728-63567750 CACCTCTGACAGCCAGACAAGGG - Intronic
1176517348 21:7796070-7796092 CCCCTCTGCCACACAGACAAGGG + Intergenic
1176898993 21:14417247-14417269 CAGCTCTGCCCCAAAGGCCAGGG - Intergenic
1177572515 21:22905244-22905266 CCCCACTGCCCGACAGGCCCTGG - Intergenic
1178651376 21:34426082-34426104 CCCCTCTGCCACACAGACAAGGG + Intergenic
1178817754 21:35946848-35946870 CACCTCTGCCAATTAGGCAAAGG - Intronic
1179571453 21:42281066-42281088 CACGGCTGCTGGACAGGCCAGGG - Intronic
1180142551 21:45901131-45901153 CACCTCTGCCAGCCTGGCGGGGG + Intronic
1180324812 22:11360957-11360979 CACCTCTTCCAGCCCGGCCCAGG + Intergenic
1180470824 22:15653426-15653448 CACTTGTGCCAGAGAGGTCAAGG + Intergenic
1180899311 22:19359251-19359273 CACCTCCCCTAGACAGGCCCAGG + Intronic
1181488664 22:23247602-23247624 CACCTCTGGCAGCCACACCACGG + Intronic
1182271170 22:29154489-29154511 TACCTCTGCCAGCTGGGCCAGGG - Intronic
1182622209 22:31624293-31624315 CAGCTCTGCCACACAGGCACTGG + Intronic
1182820137 22:33208725-33208747 CCCCACCACCAGACAGGCCATGG + Intronic
1183309443 22:37101501-37101523 CTCCTCTTCCAGACAGGGCAGGG + Intronic
1184357187 22:43990187-43990209 CAGCTCTCCCAGACAAGCCCTGG - Intronic
1184362639 22:44027373-44027395 GACCTCTTCCACACTGGCCAGGG - Intronic
1184676574 22:46046181-46046203 CAGCCCTGCCAGAGAGTCCAGGG - Intergenic
1185393222 22:50573711-50573733 CACATCTGTGATACAGGCCACGG + Exonic
951889651 3:27556363-27556385 CACCTCCGCAAAACAGGCTATGG - Intergenic
953182109 3:40605550-40605572 CAACTCTTCCAGACAGGAAAAGG - Intergenic
953743370 3:45555475-45555497 CACCTTTTCCTGGCAGGCCAGGG - Intronic
954634661 3:52065005-52065027 CACCTCTGCCAGGAAGGGCCTGG + Intergenic
954746096 3:52788361-52788383 CACCTCTGCCAGACAGGGCCAGG + Intronic
955084755 3:55692118-55692140 GAACTCTGACAGACAGGCAAGGG - Intronic
957962792 3:87280486-87280508 CCCCACTCCCAGACAGGCCCCGG - Intergenic
958118579 3:89255610-89255632 CACCTCACCCAGTCAGACCATGG - Intronic
961105121 3:124234239-124234261 CACCTCAGGCAGACAGGCAGGGG + Intronic
962298055 3:134211887-134211909 CAGCACTGACAGAGAGGCCATGG + Intronic
963296093 3:143548280-143548302 CACCACCCCCAGACAGGCCTGGG - Intronic
963968878 3:151406880-151406902 AACCTCTGCCTCCCAGGCCAAGG + Intronic
964453421 3:156835393-156835415 CAGCTCTGCCTGTCAGGCCCTGG - Intronic
964507598 3:157416474-157416496 CACTTCTGCCATATATGCCAGGG - Intronic
965310031 3:167116202-167116224 CACTCCTGACAGCCAGGCCAGGG - Intergenic
965582062 3:170279109-170279131 CACCTGAGCCAGGCAGGTCAAGG - Intronic
966070396 3:175870494-175870516 CCCCACTTCCAGACAGGCCCTGG + Intergenic
966357752 3:179099909-179099931 CACCTCAGCCAGGGAGTCCAGGG + Intergenic
968678006 4:1895895-1895917 CCCCTCTACCAGCCAGCCCAGGG - Intronic
969053697 4:4388890-4388912 CACCTGTGCCCCCCAGGCCACGG + Intronic
969447830 4:7255745-7255767 CACCTGCCACAGACAGGCCAGGG + Intronic
970085468 4:12341147-12341169 CACCTCTGTTAGACAGGCCATGG - Intergenic
970216741 4:13766872-13766894 CAGCTCTGCCAGGCAGGCCTTGG + Intergenic
972408687 4:38770013-38770035 CCCTTCTGCCAGACAGACCATGG + Intergenic
976120675 4:81777737-81777759 CACCTCCCCCGGACAGGCCCAGG + Intronic
977357829 4:95969161-95969183 CCACTCTGCCAGAGAGGCCTGGG - Intergenic
981011809 4:139933028-139933050 CACAGCAGACAGACAGGCCAAGG + Intronic
986420903 5:7580764-7580786 CACCTCTACCAGACATGTCATGG + Intronic
992037708 5:72797497-72797519 CACCTGAGCCAGGCAGGCCAAGG - Intergenic
992397856 5:76384126-76384148 CAGCCCTGCCACTCAGGCCAGGG + Intergenic
992624978 5:78628566-78628588 CAACTCAGCCAGAAAGGCAATGG + Intronic
992644773 5:78801715-78801737 CACCACTTCCAGGCAGGCCTGGG + Intronic
994537660 5:101051666-101051688 CCCCACTGCCAATCAGGCCAGGG - Intergenic
995182457 5:109241520-109241542 CACCTGGGGGAGACAGGCCATGG - Intergenic
999866095 5:155702073-155702095 CAGCTCTACCTCACAGGCCAAGG + Intergenic
1000369270 5:160519421-160519443 CACAGCTGACAGACTGGCCATGG - Intergenic
1001009632 5:168086107-168086129 CACACCTGCCAGAGAGGGCAAGG - Intronic
1002605763 5:180381828-180381850 CACAGCTGCCAGGCAGGACAGGG - Intergenic
1003173722 6:3739461-3739483 GACCTCAGCCACACAGGCCCAGG + Intronic
1004553528 6:16673265-16673287 CACCTCTAACACAAAGGCCATGG + Intronic
1004855027 6:19740861-19740883 GACCTCTGCCAAACTGGCCAAGG + Intergenic
1006613806 6:35311594-35311616 GACCCCTGCCAGTCAGGGCAAGG + Intronic
1006920420 6:37624282-37624304 GCCCTGTGCCAGACAGGCCCTGG + Intergenic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1007719151 6:43875199-43875221 CACCTCCCCCAGGCTGGCCACGG - Intergenic
1008425593 6:51352228-51352250 GACCTCTGGCAGGAAGGCCATGG - Intergenic
1008745169 6:54661030-54661052 CACCTCTTCCCGACAGGCTTCGG - Intergenic
1008785690 6:55164611-55164633 CCCCACTGCCTGACAGGCCCTGG - Intronic
1009056830 6:58346404-58346426 CACCTCTATCAGGCAGGCAATGG - Intergenic
1009234414 6:61105168-61105190 CACCTCTATCAGGCAGGCAATGG + Intergenic
1009570802 6:65381453-65381475 CCACTCTGCCCGACAGGCCTCGG - Intronic
1011726206 6:90212899-90212921 CACTTCTGGCACACAGGCTAGGG + Intronic
1014035630 6:116764819-116764841 CTCTTGTGCCAAACAGGCCACGG - Intronic
1015698926 6:136013181-136013203 CACTTCTCTAAGACAGGCCAAGG + Intronic
1016070023 6:139727476-139727498 CAGTTCTGCCAGACAGTCTAGGG + Intergenic
1019042291 6:169117304-169117326 GCCCTCTGCCAGTCAGGTCAGGG - Intergenic
1019060473 6:169254052-169254074 GGCCCCTGCCAGACAGGCCTGGG + Intergenic
1019432185 7:1004221-1004243 CACCCGGGCCAGCCAGGCCATGG + Intronic
1019624524 7:2009252-2009274 CACTCCTGCCAGCCAGGACATGG + Intronic
1023608125 7:41947852-41947874 CATCACTGCCAGGCAGGCCCAGG - Intergenic
1023637641 7:42228342-42228364 CATCTCCGCCAGCCAGGCCGCGG + Intronic
1024250496 7:47502477-47502499 CACTTCCACCAGACAGGCCCAGG - Intronic
1024346760 7:48321718-48321740 CTCCTCTGCCAGCCTGGCCTAGG - Intronic
1024518056 7:50277496-50277518 CATCTCTGCCAGGAGGGCCAGGG - Intergenic
1025142683 7:56479007-56479029 CATCTCTGACTGACAGGGCAGGG - Intergenic
1025155976 7:56606158-56606180 CACAACTGCCAGCCAGGACAGGG + Intergenic
1025708738 7:63889607-63889629 CATCTCTGACTGACAGGGCAGGG - Intergenic
1025750411 7:64289064-64289086 CACCTCTGAGAGACTGGCCCAGG + Intergenic
1026852750 7:73735350-73735372 CACCTCTTCCAGACAAGACTTGG + Intergenic
1032211091 7:129914714-129914736 ACTCTCTGCCAGACAGTCCAGGG + Intronic
1032693958 7:134317057-134317079 CAGCTCCGCCAGAGAGGACAGGG + Intergenic
1034342542 7:150367792-150367814 CAATTATGCCAGACATGCCATGG + Intergenic
1035457399 7:159017476-159017498 CCCCTCTTCCAGCCAGCCCAGGG + Intergenic
1038269542 8:26064172-26064194 TACCTCTCCCCCACAGGCCAGGG + Intergenic
1038579930 8:28739114-28739136 GACCTCAGCAAGAAAGGCCAAGG - Intronic
1042046921 8:64663721-64663743 CATGTCTGACAGACAGGACAAGG + Intronic
1043694293 8:83201080-83201102 CACCTGTGCCAGATAGGCAGAGG - Intergenic
1044914150 8:97094447-97094469 CATCCATGCCAGACAGCCCAGGG + Intronic
1045963964 8:108001870-108001892 ACCCCCTGCCAGACAGGCCCTGG - Intronic
1047763262 8:127969839-127969861 CCTCTATGTCAGACAGGCCAGGG - Intergenic
1048978022 8:139683876-139683898 CACCTGTGCCCCATAGGCCAAGG - Intronic
1049403696 8:142442386-142442408 CTCCTCTCCCAGAGAGGGCAGGG + Intergenic
1049503999 8:142985225-142985247 CTCCCTTGCCAGGCAGGCCATGG - Intergenic
1051273715 9:15379390-15379412 CACCTCTCCCAGCCAGGGGAAGG + Intergenic
1053199600 9:36143451-36143473 CCCATGTCCCAGACAGGCCACGG - Intronic
1053514864 9:38722271-38722293 CTTATCTGCCAAACAGGCCAAGG + Intergenic
1055200205 9:73649571-73649593 CAGCAGTGCCGGACAGGCCATGG - Intergenic
1055429987 9:76233539-76233561 CACACCTGCCAGAGATGCCAAGG + Exonic
1055869741 9:80860882-80860904 CACCTCTAACAGACAGCACATGG + Intergenic
1057605887 9:96497326-96497348 CCCCACTCCCACACAGGCCAGGG + Intronic
1057651794 9:96925818-96925840 CAGCTCTGCCAGACACAGCATGG + Intronic
1058444306 9:105040826-105040848 CACCTCTGTCAGACAGGTTATGG + Intergenic
1059054590 9:110966112-110966134 CCCCACTCCCAGACAGGCCCTGG - Intronic
1059630752 9:116119175-116119197 CCCCTTTCCCAGACAGGCCCTGG + Intergenic
1060010045 9:120035956-120035978 CCACTGTGCCAGGCAGGCCAGGG - Intergenic
1060909333 9:127336784-127336806 CAGCTCTGCCAGACAGGCATGGG + Intronic
1060922969 9:127435586-127435608 CACCTCACCCAGCCATGCCAAGG - Intronic
1061010237 9:127950384-127950406 CACCTCTGCCACCCTGACCACGG - Intronic
1061509175 9:131049982-131050004 TCCCTCTGCCAGAGAGGCCGGGG + Intronic
1061711223 9:132489325-132489347 CAACTCTGCAAGGGAGGCCATGG - Intronic
1061876476 9:133546588-133546610 CACCCATGCCAGCCAGGCCAGGG + Intronic
1185738609 X:2512443-2512465 CACACCTGCCAGACTGGGCAGGG - Intergenic
1187700932 X:21963697-21963719 CAGCTCAGCCACCCAGGCCAGGG + Intronic
1188653877 X:32666361-32666383 CTCCACTCCCAGACAGGCGATGG + Intronic
1190011611 X:46789998-46790020 CACCTCAGCCAGGGAGGTCAAGG + Intergenic
1193301236 X:79891582-79891604 CACTTGTGCCAGAAAGCCCAGGG - Intergenic
1193383606 X:80845121-80845143 TACTTCTGCCAGAGAGGGCAGGG - Intergenic
1194910958 X:99644068-99644090 CCCCACTCCCAGACAGGCCCAGG + Intergenic
1195610601 X:106862980-106863002 CTGCTCTGCCAGAGAGGCCAAGG + Intronic
1195844602 X:109212388-109212410 CCCCACTGCCCGACAGGCCCTGG - Intergenic
1196010969 X:110887675-110887697 CTCCTCTGCCAGGCAGGACAGGG + Intergenic