ID: 1160909833

View in Genome Browser
Species Human (GRCh38)
Location 19:1469360-1469382
Sequence GCGGGGCGAGGCGCCCTGGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 346}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160909833 Original CRISPR GCGGGGCGAGGCGCCCTGGG GGG (reversed) Exonic
900095520 1:938535-938557 GCGCCTCGAGGCGGCCTGGGGGG + Intronic
900145700 1:1157927-1157949 CCGGGGCCTGGCACCCTGGGTGG + Intergenic
900221680 1:1512483-1512505 GCGGGGCGGGGCGGCGCGGGCGG + Intronic
900364299 1:2304590-2304612 GCGGGGCGAGTGGTGCTGGGAGG + Intronic
901796141 1:11680814-11680836 GCGGGGCGAGGGGGCGCGGGCGG - Intronic
901825680 1:11859360-11859382 GAGGGGAGAGGCGCCGCGGGTGG - Intergenic
903142242 1:21345574-21345596 GCAGGGCGCGGGGGCCTGGGTGG + Intergenic
903493983 1:23752059-23752081 GCAGGGCCAGGTGCTCTGGGTGG - Intronic
903781090 1:25820436-25820458 GAGGGGCGACTCGCCCTGGCGGG + Intronic
904181388 1:28668960-28668982 GCGTGGGGAGGCGCCCGCGGAGG - Intronic
904724908 1:32539731-32539753 GCGGCGGGAGGCGCCCGGGAGGG + Intronic
904770003 1:32875868-32875890 GGGGGGCCAGGTGCCCTGTGAGG + Intergenic
904775080 1:32901418-32901440 GCGGGGCCGGGCGGCCCGGGGGG - Intronic
905202501 1:36323656-36323678 GCGGGGCGGGGCGGGCGGGGAGG + Intronic
905422798 1:37859768-37859790 GCGTGGGGAAGCGCCCGGGGTGG + Intergenic
905884560 1:41484791-41484813 GTCGGGCCAGGCGCCCGGGGAGG - Intergenic
906197086 1:43936148-43936170 GCGGGGCGCGGAGCCCAGGGAGG - Exonic
906640345 1:47437698-47437720 GTGGGGCGAGGCGACAGGGGCGG - Exonic
906653752 1:47533238-47533260 TCGGGGGGAGGCGCGCTGGGTGG + Intergenic
906759372 1:48360728-48360750 GAGGGGCCAAGGGCCCTGGGAGG + Intronic
907767351 1:57424131-57424153 GCGGGGCGGGGGGCCGCGGGAGG - Intronic
908257988 1:62318469-62318491 GCTGGGCAAAGCGCCCTCGGCGG + Intronic
908916228 1:69129649-69129671 GAGGGGTGAGGGGCACTGGGAGG + Intergenic
911789630 1:101996976-101996998 GCGGCGGCAGCCGCCCTGGGGGG + Exonic
911902657 1:103525513-103525535 GCGGGGCGGGGCGCACGGCGGGG - Intergenic
911902664 1:103525530-103525552 GCGGGGCGGGGCGCACGGCGGGG - Intergenic
911902671 1:103525547-103525569 GCGGGGCGGGGCGCACGGCGGGG - Intergenic
911902678 1:103525564-103525586 GCGGGGCGGGGCGCACGGCGGGG - Intergenic
911902685 1:103525581-103525603 GCGGGGCGGGGCGCACGGCGGGG - Intergenic
911902692 1:103525598-103525620 GCGGGGCGGGGCGCACGGCGGGG - Intergenic
911902699 1:103525615-103525637 GCGGGGCGGGGCGCACGGCGGGG - Intergenic
911902706 1:103525632-103525654 GCGGGGCGGGGCGCACGGCGGGG - Intergenic
911902713 1:103525649-103525671 GCGGGGCGGGGCGCACGGCGGGG - Intergenic
915082065 1:153359264-153359286 GCGGAGGGAGGGGCACTGGGAGG - Intronic
915310157 1:155002526-155002548 GCGGAGGGAGGGGGCCTGGGGGG + Intergenic
916497299 1:165356949-165356971 TCGGGGTGAGGGGCACTGGGGGG - Intergenic
920528600 1:206685627-206685649 GCGGGGCGGGGCGGCCGGGCCGG + Intronic
921155131 1:212433136-212433158 GCGGGCCGAGGGACCCGGGGTGG + Intronic
922807339 1:228397232-228397254 ACGGGGCGAGGCTCCAGGGGCGG - Intronic
924198865 1:241639782-241639804 GCGGTGCGGGGCGGGCTGGGGGG + Intronic
1063995129 10:11611665-11611687 CCCGGGCGAGCCGCCCTGGGAGG - Intronic
1066963647 10:42242477-42242499 GCGAGGCGGGGCGCGCGGGGAGG - Intergenic
1067227442 10:44385144-44385166 GCGGGGCGGGGCGCGCGGTGAGG + Intronic
1067293295 10:44959720-44959742 GCGGGGCGAGGGGCGAGGGGCGG + Intronic
1068955757 10:62817837-62817859 GCGGGCTGGGGCGCACTGGGAGG - Intronic
1069729672 10:70602602-70602624 GGGGGGCCTGGGGCCCTGGGTGG - Intronic
1070660719 10:78303466-78303488 GCGGGGCGGGGCGGCCCGGCCGG - Intergenic
1070835705 10:79445701-79445723 GCGGGGCGGGACGCAGTGGGCGG - Intergenic
1071695038 10:87862354-87862376 GCGGGGCGAGGAGACCTAGGAGG - Exonic
1073156939 10:101354491-101354513 GCGGCGCGCGGGGCCCTGGAGGG + Intronic
1073196182 10:101694298-101694320 GCGGGGCGCCGCGGCCTGGTCGG - Intronic
1073250501 10:102118043-102118065 GAGGGCTGAGGCGCCCTGGCAGG - Intronic
1076878761 10:133230129-133230151 GCGGGGCGGGGCGCGCGGGGCGG + Intergenic
1076916198 10:133424061-133424083 GCGGGGGGAGGCGGCATGGGGGG + Intronic
1076920034 10:133446476-133446498 GCGGGGCGGGGTCCCCGGGGCGG - Intergenic
1076936306 10:133568856-133568878 GCGGGGGGAGGCGGCATGGGGGG + Intronic
1077204663 11:1336696-1336718 GCGGGGCGGGGCGGGCGGGGGGG + Intergenic
1077406387 11:2384295-2384317 GTGGGGCGGGGCGCCTTGGGAGG + Intronic
1077532630 11:3104356-3104378 GCTGGGCGAGGCGTCCCAGGTGG - Exonic
1078156718 11:8806111-8806133 ACTGGGCAAGGGGCCCTGGGCGG - Intronic
1080036746 11:27719401-27719423 GCCGGGCGAGGGGGCCTGGGCGG - Intronic
1081774128 11:45665924-45665946 CCGCGGCGAGGGGCGCTGGGGGG - Intergenic
1081812707 11:45922561-45922583 GCGGGGCCAGGACCCCGGGGGGG + Intronic
1082811861 11:57483158-57483180 GCGGGGGGCGGCGACCCGGGAGG - Intergenic
1083672354 11:64306303-64306325 GCGGGACGCGGCGCCCCGGGAGG + Exonic
1084456291 11:69269943-69269965 GTGGTGTGAGGAGCCCTGGGTGG + Intergenic
1084967550 11:72752428-72752450 GCGGGCGGAAGCGCCCGGGGGGG - Intronic
1086337164 11:85811261-85811283 GCCGGGCGAGGAGGCCGGGGCGG - Intergenic
1086455500 11:86955584-86955606 GCGGGGCGGGGCGCTAGGGGAGG - Intergenic
1087175199 11:95089768-95089790 GCCGGGCGGGGCGGCCCGGGCGG - Intergenic
1089452617 11:118608323-118608345 GCGTGGCAAGGCGCCCCAGGCGG - Intronic
1089529978 11:119121440-119121462 GTGGGGCTAGGCGTCCCGGGCGG - Intergenic
1089624441 11:119742365-119742387 GCTGGGCGCGCCGGCCTGGGGGG + Intergenic
1090817954 11:130314961-130314983 GCGGGGCGGAGCGCGCTCGGGGG + Intergenic
1091140259 11:133228571-133228593 GCAGGGCGCAGCGTCCTGGGAGG - Intronic
1091286570 11:134411768-134411790 GCGCGGCGGGGCGCCCGCGGGGG + Intronic
1091718424 12:2795567-2795589 GCGGGGCGAGGCGACCGCCGCGG + Intronic
1092149302 12:6236128-6236150 GAGGGAGGAGGTGCCCTGGGAGG + Intronic
1095958660 12:47820114-47820136 GCGGGGCGCGGCGCACTGCCGGG + Intronic
1096489627 12:52006705-52006727 GCGGGATGAGGCCCCCGGGGCGG - Intergenic
1096695282 12:53344850-53344872 GCCGGGCCAGGCGCCCGGGCAGG + Intronic
1096980971 12:55728251-55728273 GAGTGGCGAGGGGTCCTGGGGGG - Intronic
1102025525 12:109712371-109712393 GCCGGGAGAGGCGCCCGCGGCGG - Intergenic
1103487027 12:121289913-121289935 GCGGGGCGGGGAGCCAAGGGAGG + Intronic
1103749928 12:123151351-123151373 GGTGGGCGAGGAGCCCGGGGCGG - Intergenic
1104841932 12:131829637-131829659 GCTGGGCGAGGGGCCCTGCCAGG - Intronic
1105217434 13:18297480-18297502 CCGGGGCGAGGCACGCAGGGAGG - Intergenic
1105344657 13:19561393-19561415 GCGGGGCGCGGCGCCCCGGGAGG - Intergenic
1105535381 13:21260174-21260196 GCGGGGCGCGGCGCCCCGGGAGG + Intergenic
1111199969 13:84922620-84922642 GCGGGGCGGGGGGGCCGGGGGGG - Intergenic
1112652730 13:101416392-101416414 GCCAGGCGCGGCGCCCAGGGCGG + Intronic
1113571239 13:111359703-111359725 GCGGGGTGACGTGCCCTGTGGGG + Intergenic
1113803217 13:113096960-113096982 GCACGGCCAGGCGCTCTGGGTGG - Exonic
1113820534 13:113209514-113209536 GCGGGGCGGGGCGCGCGAGGAGG + Intronic
1113835416 13:113325610-113325632 GTGAGGCGGGGCCCCCTGGGAGG + Exonic
1113866204 13:113526999-113527021 GCAGTGCCAGGCGGCCTGGGTGG + Intronic
1117039905 14:51760162-51760184 GGGGGGCGAGGCGCCCTCAGCGG - Intergenic
1118925741 14:70188634-70188656 CCAGGGCGAGGGGCCCCGGGAGG + Exonic
1118943417 14:70359991-70360013 GCCGGGCGCGGTGGCCTGGGTGG + Intronic
1120953351 14:90061714-90061736 GCGGGGCGGGGCGGCGGGGGGGG - Intergenic
1121279407 14:92688256-92688278 GTGAGGGGAGGCGCCCCGGGAGG - Exonic
1121342772 14:93115323-93115345 GCGGGGCGGGGCGCGGCGGGCGG + Intronic
1121437162 14:93927524-93927546 GAGGGGCGAGGTGCCGTGGGTGG + Intronic
1121473452 14:94174258-94174280 GCGGGGCGAGGCTCGCGGGCGGG - Intronic
1121754504 14:96391872-96391894 GCGGGGCGAGTCGTGCCGGGGGG - Intergenic
1122230939 14:100306150-100306172 CCGGGGCGAGGCGTCCGGGGAGG - Intronic
1122638359 14:103141281-103141303 GCGGGGGAAGCCGTCCTGGGAGG + Intergenic
1122691597 14:103534346-103534368 GCGGCGCCAGGCCCCATGGGGGG + Intronic
1122776103 14:104117615-104117637 GCGGGGCGCGGCGCATGGGGCGG - Intergenic
1122913095 14:104843375-104843397 GGGGGGCTTGGCGCGCTGGGCGG - Intergenic
1122978632 14:105181332-105181354 GCGGGGCGGGGCGGCCGAGGTGG + Intergenic
1123004393 14:105314462-105314484 GCGGGGCGGGGCGCCCCGGGCGG + Exonic
1123047597 14:105526499-105526521 GCGGGCCGAGGGGCGCGGGGCGG + Intergenic
1124239539 15:28018466-28018488 GTGGGCCGAGTCGTCCTGGGAGG - Exonic
1124922344 15:34039018-34039040 GCGGAGCGAGGAGCTCGGGGAGG - Exonic
1125852724 15:42920397-42920419 GGGGAGGGCGGCGCCCTGGGGGG + Intronic
1128321994 15:66701083-66701105 GCGGGGCGCCGCGCCGGGGGTGG + Intergenic
1128382256 15:67121481-67121503 GCGGGGGGTGGCTGCCTGGGAGG + Intronic
1128553627 15:68615159-68615181 GCCGGCCTAGGAGCCCTGGGAGG - Intronic
1128635271 15:69298863-69298885 GCGGGGCGGGGCGGCCCCGGGGG - Intergenic
1129326047 15:74800751-74800773 GCTGGGCCGGGCCCCCTGGGGGG + Intronic
1129685324 15:77682818-77682840 GCCTGGCGAGGCTTCCTGGGCGG - Intronic
1131693951 15:94855942-94855964 GCAGGGCGAGCTGCCCCGGGAGG + Intergenic
1131827585 15:96333158-96333180 GGTGGGCGAGGGGCCCTGGGCGG + Intronic
1132111635 15:99105910-99105932 GCGGCGCGAGGCGCTCGGGTTGG + Exonic
1132163943 15:99566388-99566410 GAGGAGCTAGGCGCCCGGGGAGG + Intronic
1132480630 16:164811-164833 GCGGGGCGGGGCGGGCGGGGCGG + Intronic
1132641574 16:980781-980803 GCGGGGTGTGCCGCCCTGGTGGG - Intronic
1133273858 16:4625124-4625146 TCGGGGCGGGGCGCCCTGCTCGG + Intronic
1134172064 16:11976692-11976714 CCGGGGCGGGGCGGCCGGGGCGG + Intergenic
1136488022 16:30585583-30585605 GCCGGGCGCGGCGCCAGGGGCGG + Exonic
1136570379 16:31093273-31093295 GCGGGGCGGGGCGGGCAGGGAGG + Intronic
1136724809 16:32349002-32349024 GCGAGGCGGGGCGCGCGGGGAGG - Intergenic
1136843135 16:33555041-33555063 GCGAGGCGGGGCGCGCGGGGAGG - Intergenic
1138591209 16:58000614-58000636 CCGGGGCGAGGAGCGCCGGGAGG + Intronic
1141585019 16:85027973-85027995 GTGGGGCGAGGGGCGCGGGGAGG + Intronic
1141694232 16:85612250-85612272 GCGGGGCGGGGCGGGGTGGGCGG + Intronic
1142379288 16:89722362-89722384 GCGGGACAAGCCGCCCTGTGGGG - Intronic
1203001621 16_KI270728v1_random:168753-168775 GCGAGGCGGGGCGCGCGGGGAGG + Intergenic
1203133224 16_KI270728v1_random:1705159-1705181 GCGAGGCGGGGCGCGCGGGGAGG + Intergenic
1203153300 16_KI270728v1_random:1855339-1855361 GCGAGGCGGGGCGCGCGGGGAGG - Intergenic
1142494122 17:297222-297244 GATGGGAGAGGTGCCCTGGGTGG - Intronic
1143166408 17:4899310-4899332 TGGGGGCGAGGCGGCCCGGGGGG + Exonic
1143174365 17:4947982-4948004 GAGGGGCGCGGCGCCCGGTGCGG - Intronic
1146936759 17:36816839-36816861 GCGGGGCGGGGCGGGGTGGGGGG - Intergenic
1147338230 17:39739498-39739520 GCGGGGCGTGGAGTACTGGGCGG + Intronic
1147925330 17:43942320-43942342 GCAGGGCCAGGGGCCTTGGGAGG - Intronic
1148152730 17:45405753-45405775 GACGGGCGAGACGGCCTGGGAGG - Exonic
1148549448 17:48541932-48541954 GCCGGGCGAGAAGCCCAGGGTGG - Intronic
1148907891 17:50922866-50922888 GCTGGGTGAGGCTGCCTGGGTGG + Intergenic
1149263211 17:54900934-54900956 GCGGGGAGAGACGCCCAGGCAGG + Intronic
1149891309 17:60392300-60392322 GCGGAGCGTGCGGCCCTGGGCGG - Intronic
1151358073 17:73571951-73571973 GCGGGGCCAGCTCCCCTGGGTGG + Intronic
1151365001 17:73611485-73611507 CCTGGGAGAGGTGCCCTGGGGGG + Intronic
1151749703 17:76029506-76029528 GCAGGGGGAGGTGCCCTGGGCGG + Intergenic
1151801935 17:76384077-76384099 GCCTGGAGAGGCGCCCCGGGTGG + Intronic
1152197243 17:78925071-78925093 GCGGGCCGCGGCGCCCATGGCGG + Exonic
1152210691 17:79001567-79001589 GGTGGGCGAGGGGGCCTGGGCGG - Intronic
1152625663 17:81386950-81386972 GCGGGGCGCGGCGGCGAGGGTGG + Intergenic
1152641711 17:81452117-81452139 GCGTGGCGGGGGGGCCTGGGAGG + Intronic
1152697589 17:81804579-81804601 GCGGGGCCCGGGGCCCTGAGTGG - Intronic
1158608743 18:58919542-58919564 GACTGGAGAGGCGCCCTGGGGGG - Exonic
1159045706 18:63367125-63367147 GCGGGGCCAGGGGCCCGGAGCGG + Exonic
1160157168 18:76442683-76442705 GCAGGCCGAGGCGCTCTTGGTGG + Exonic
1160256133 18:77250249-77250271 GCGGGCGGAGGCGCCCGGGAAGG + Intergenic
1160745327 19:708772-708794 CCGGGGCGGGGCGCGCGGGGCGG + Intergenic
1160771177 19:831890-831912 GCGGGGCTGGGCTCCATGGGAGG - Exonic
1160909833 19:1469360-1469382 GCGGGGCGAGGCGCCCTGGGGGG - Exonic
1160948096 19:1652621-1652643 GCGGGGCGGGGCGGCGCGGGCGG - Intergenic
1161048894 19:2151621-2151643 GCGGGGCGGGGCTTTCTGGGAGG - Intronic
1161943867 19:7422346-7422368 GCGGGGCGGGGGGGCATGGGCGG - Intronic
1162344333 19:10110844-10110866 GGTGGGCGAGGCGCCCAGTGAGG + Exonic
1162418420 19:10552206-10552228 GCGGGGCGAGGTGCAGTGGAAGG - Exonic
1162959418 19:14117371-14117393 CCGGGGCAAGGGGCGCTGGGGGG + Intronic
1163026888 19:14517887-14517909 GCGGGAGGAGGCGCCCGGGGAGG + Intronic
1164693116 19:30225700-30225722 GCGGGGCGCGGCGCGGTGCGGGG + Intergenic
1164698460 19:30264362-30264384 GCGGGGGGCGGGGGCCTGGGGGG - Intronic
1165079249 19:33298344-33298366 GGAGGGCGAGGCCCCCGGGGGGG - Intergenic
1165349681 19:35269062-35269084 GGGGGGCGCGGGGCCCGGGGGGG - Exonic
1165433927 19:35786794-35786816 CCGGGGCGAGATGGCCTGGGGGG - Intronic
1165463754 19:35959876-35959898 GCGGGCCGCGGCGGCCTCGGGGG - Intergenic
1166367248 19:42284017-42284039 GCGGGGGGAGGCGCGGCGGGGGG + Intronic
1166894877 19:46016878-46016900 GCGGGGCTGGGCGGGCTGGGAGG + Intronic
1167075047 19:47243352-47243374 ACGGGGCGAGGGGGCCGGGGAGG - Intergenic
1167080567 19:47274257-47274279 GCGGAGCTAGGCTGCCTGGGCGG + Intergenic
1167158028 19:47750980-47751002 GCAGGGCGAGCTGCCCCGGGAGG + Exonic
1167449195 19:49557034-49557056 GCGGGGCGCCGCGGGCTGGGCGG - Intronic
1167471303 19:49677672-49677694 CCGGGGAGGGGCGCCCAGGGGGG + Intronic
1167578610 19:50329345-50329367 GCGGGGCGGGGCGTCAAGGGAGG + Exonic
1168239512 19:55082108-55082130 GCGGGCCAAGCCGCCCTCGGAGG + Exonic
925088430 2:1132824-1132846 GCAGGGCATGGGGCCCTGGGAGG - Intronic
926008248 2:9389322-9389344 GCGGGGCGGGGGGCCCAGGAAGG + Intronic
927053469 2:19350790-19350812 GTGGGGGCGGGCGCCCTGGGAGG - Intergenic
928186496 2:29115546-29115568 GCGGCGGGAGGCTCCGTGGGCGG + Exonic
929604184 2:43224548-43224570 GCGGGGAGGGTCGCGCTGGGCGG + Exonic
929808440 2:45169127-45169149 GCGGCGCGAAGGGCTCTGGGAGG - Intergenic
929863222 2:45696942-45696964 GTGGGGTGTGGGGCCCTGGGAGG - Intronic
931429211 2:62196073-62196095 GCGGGGCCGGGCGCCCGCGGCGG + Intergenic
932313906 2:70767448-70767470 GCGGTGCGAGGCGGGCTTGGCGG - Intronic
932467364 2:71932457-71932479 GCAGGGCGACTCCCCCTGGGGGG - Intergenic
932882417 2:75516063-75516085 GAGGGGCCAGGGGCCCTGCGGGG + Intronic
934296885 2:91749203-91749225 CCGGGGCGAGGCACGCAGGGAGG + Intergenic
935011529 2:99141098-99141120 GCGGGCCGAGGAGCCCGGGGAGG - Intronic
938030336 2:127986820-127986842 CCGTGGCGATGAGCCCTGGGCGG + Exonic
941188283 2:162344312-162344334 GCGGGGTGTGGCGCCCCCGGGGG + Intronic
944060092 2:195563196-195563218 GAGGGGCGGGGGGCCCTAGGGGG - Intergenic
945235203 2:207626252-207626274 GTGGGGCGAGGGGCCCCAGGAGG - Intergenic
945305548 2:208255448-208255470 ACGGGACAGGGCGCCCTGGGCGG + Intronic
945833123 2:214809701-214809723 GAGGGGCGGGGCGCGCGGGGAGG + Exonic
946248401 2:218399745-218399767 GCGCGGCTAGGCGGACTGGGAGG - Exonic
946855270 2:223944763-223944785 GAGGGGCGAGGTGGGCTGGGAGG + Intronic
948477742 2:238231390-238231412 GCGGGGCCCGGCGGCCTGGACGG - Exonic
948876499 2:240832473-240832495 GCGGGGCGAGGTTTCCTGCGGGG - Intergenic
948887373 2:240891012-240891034 GCGGGGTGAGCCACCCTGAGGGG + Intronic
1169113282 20:3046541-3046563 GCGGGGCGGCGCGGCCTGGCCGG + Intronic
1172666845 20:36606038-36606060 GCGGAGCGACGCGGCCTGGGAGG + Exonic
1173251704 20:41367003-41367025 GCAGGCCGCCGCGCCCTGGGAGG + Intergenic
1173750390 20:45470918-45470940 GCTGGGGGAGGCCCCCAGGGAGG - Intronic
1174182964 20:48686639-48686661 GCGGGGCGGGGCAGCCTGGCTGG - Intronic
1174804696 20:53594541-53594563 GCGGGGCGGGGGGCGCGGGGAGG - Intronic
1176025474 20:62983235-62983257 GCGGTGCCAGGTGCCCTGGCTGG - Intergenic
1176081207 20:63273953-63273975 GTGGGGAGAGGTGCCCTGGCGGG - Intronic
1176129010 20:63488411-63488433 GCACGGCGAAGCGGCCTGGGGGG + Exonic
1176147170 20:63570753-63570775 GCGGGGGCAGGCGGCCTGGCAGG - Exonic
1176148140 20:63574437-63574459 ACGGGGCGTGGGGCCCTGGAGGG - Intergenic
1176242129 20:64080033-64080055 GCGGGGCGCGGCGGGCGGGGCGG - Intergenic
1176242132 20:64080038-64080060 GCGGGGCGGGGCGCGGCGGGCGG - Intergenic
1178407943 21:32339898-32339920 GCCGGGCAAGGTGACCTGGGAGG - Intronic
1178610239 21:34073492-34073514 GCGGGGCGGGGCGCGCCGAGGGG + Intronic
1178619092 21:34158612-34158634 GAGGGTGGAGGGGCCCTGGGAGG + Intergenic
1179626935 21:42654053-42654075 AAGGGGCGACTCGCCCTGGGGGG + Intronic
1179961026 21:44767074-44767096 GCTGGGGGGGGCACCCTGGGAGG - Intergenic
1180096062 21:45555646-45555668 GCGGGGCGGGGCGGCCCGCGTGG + Intergenic
1180109934 21:45643063-45643085 GCGGGGCGAGCCTTCGTGGGCGG - Intergenic
1180256851 21:46635606-46635628 GCGGGGCGCCGGGCCCTGGGCGG + Intronic
1180650351 22:17370748-17370770 GCGGAGCGCGGCGCACTCGGCGG + Intronic
1180921601 22:19524304-19524326 GTGCTGCGCGGCGCCCTGGGCGG + Exonic
1181162253 22:20965773-20965795 GGGGCGCCAGGAGCCCTGGGAGG + Intronic
1181478065 22:23180755-23180777 GCGGGGCGGGGCGCGCCGGGGGG - Exonic
1181811393 22:25405547-25405569 GCAGGGCGAGGAGCGCGGGGAGG - Intergenic
1182211367 22:28679910-28679932 GCGAGGCGGGGCGCGCGGGGAGG - Intergenic
1183301526 22:37061321-37061343 GCAGGGCCAGGGGGCCTGGGTGG - Intronic
1183982663 22:41551132-41551154 GCGGGGTGAGGGGCAGTGGGAGG + Intergenic
1184086915 22:42270729-42270751 GCGGGGCGGGGCGCGCGGCGGGG + Intronic
1184152948 22:42649146-42649168 GTGGGGCGCGGCGGGCTGGGCGG + Intronic
1184228271 22:43143192-43143214 GGAGGAGGAGGCGCCCTGGGCGG - Exonic
1184236767 22:43187171-43187193 GCGGGGGGGGGGGCGCTGGGAGG - Intergenic
1184470293 22:44692241-44692263 CCGGGAGGAGGAGCCCTGGGTGG - Intronic
1184470340 22:44692358-44692380 CCGGGAGGAGGAGCCCTGGGAGG - Intronic
1184470420 22:44692562-44692584 CCGGGAGGAGGAGCCCTGGGTGG - Intronic
1184472142 22:44702153-44702175 GCGGGTCTCGGCGCCCCGGGGGG - Intronic
1184738049 22:46410596-46410618 GCGGGGAGAGGCGGCCACGGCGG + Intronic
1185258508 22:49849308-49849330 CCGGGGCGCGGCGCCCTTGAGGG - Intergenic
1185259518 22:49853818-49853840 GCGCCGCGCGGGGCCCTGGGAGG + Intergenic
1185278667 22:49960751-49960773 CCCGGGCGAGGCGGCCGGGGCGG + Exonic
1185313919 22:50170673-50170695 GCGGGGCGGGGGGCGCGGGGCGG - Intergenic
1185347698 22:50317620-50317642 GGGGGGCTGGGGGCCCTGGGAGG + Intronic
949461985 3:4303533-4303555 GCGGGGCCAGGCGGCGCGGGAGG + Intronic
949938605 3:9136402-9136424 GCGGGGCGGGGCGGTCGGGGGGG - Intronic
950024274 3:9809964-9809986 GCGGGATCAGGGGCCCTGGGAGG + Intronic
950457448 3:13101122-13101144 GCGCAGCGAGGAGCCATGGGAGG + Intergenic
950661536 3:14469729-14469751 GAGGGGCCAGGGGCTCTGGGAGG - Intronic
953099221 3:39809380-39809402 GAGGGGCGGGGCGCACCGGGAGG - Intronic
955325738 3:58008381-58008403 GCGGGGCCAGGCGCCTCGCGCGG + Exonic
956675079 3:71725451-71725473 GCGGGGCGGGGCGCGCGGGGCGG - Intronic
961551567 3:127672885-127672907 GCGGGGCGGGGAGGCCGGGGCGG + Intergenic
961713844 3:128845928-128845950 GCGGGGCCAGGCGGCAGGGGCGG + Intergenic
961735939 3:129002181-129002203 TCGGGGCCAGGCGCGCAGGGCGG - Exonic
962363067 3:134757694-134757716 GAGGGGCTAGGGGCCCTTGGGGG + Intronic
966696236 3:182793406-182793428 GCGGGCCGGGGCGCCGGGGGCGG + Intergenic
968035325 3:195543418-195543440 GCGGGGCGAGCAGCCCGGGCGGG - Intergenic
968150686 3:196335167-196335189 GAGGGGAGAGGTGCCCTGGGAGG + Intronic
968150778 3:196335410-196335432 GAGGGGAGGGGTGCCCTGGGAGG + Intronic
968150793 3:196335445-196335467 GAGGGGAGGGGTGCCCTGGGAGG + Intronic
968150810 3:196335480-196335502 GAGGGGAGGGGTGCCCTGGGAGG + Intronic
968498487 4:932132-932154 GCGGGTCCAGGCTCCCTGGGCGG - Exonic
968514917 4:1011861-1011883 GCGGGATGCGGCGCCCGGGGCGG + Intronic
968581223 4:1396236-1396258 GCGGGGGGAGGAGCCTGGGGGGG + Intergenic
968653128 4:1767753-1767775 GCGGGGCGCGGGGCGCGGGGCGG - Intergenic
968879799 4:3293058-3293080 GCGGGCCGAAGCGCCCGGAGCGG + Intronic
969379416 4:6783682-6783704 GCGGGGCGCGGCGCGGGGGGCGG + Intronic
969714586 4:8862068-8862090 CCGGCGCCAGGTGCCCTGGGTGG + Intronic
973888451 4:55346330-55346352 GCGGGCCATGGCTCCCTGGGCGG + Exonic
976733112 4:88284058-88284080 GCGGCGCGAGGCGGGCAGGGTGG - Intronic
977607230 4:98995572-98995594 CCGGGGCGGGGCGCGCTGCGTGG + Intergenic
977941955 4:102868946-102868968 GCGGGGCGGCGGGCCCTGGGAGG - Intergenic
978189402 4:105895381-105895403 GCGGGGAGGGGCGCCAGGGGCGG - Intronic
978189552 4:105895948-105895970 CCGGGGCGAGTCGCCCTCGGGGG - Intronic
978623856 4:110662378-110662400 GAGGGGTGAGGAGCTCTGGGTGG + Intergenic
983577163 4:169271457-169271479 GCGGGGCTGGGAGCCCTGGACGG + Intergenic
984758479 4:183344657-183344679 AAGGGGCGATGGGCCCTGGGCGG - Intergenic
985377947 4:189362033-189362055 AGGGGGTGAGGCGCTCTGGGAGG + Intergenic
985996034 5:3597334-3597356 GGCGGGCGCGGGGCCCTGGGAGG + Intronic
986607671 5:9538272-9538294 GCGGGGGGAGGTGCGCGGGGTGG + Intronic
986608599 5:9546108-9546130 GCGGGGCGGAGAGCGCTGGGCGG + Intergenic
988722492 5:33892286-33892308 CCCGGGAGAGCCGCCCTGGGAGG + Intergenic
989368223 5:40679741-40679763 GCGGGGCTGGGCGCGCGGGGTGG - Exonic
993901023 5:93584512-93584534 GCGGGGCGCAGCGCCGGGGGCGG - Exonic
993901332 5:93585630-93585652 GCGGGGGGAGACGCCGGGGGAGG - Intronic
995759129 5:115544891-115544913 GCGGGGCGTCGCGGCCGGGGTGG + Exonic
1001159503 5:169300866-169300888 GCGGAGCGGGGCGCTCCGGGCGG + Intronic
1001159554 5:169301024-169301046 ATGGGGCGTGGCGCCCGGGGAGG + Intronic
1002524459 5:179807344-179807366 GAGCGGGGAAGCGCCCTGGGCGG - Intronic
1002662785 5:180802863-180802885 GCGGGGCGGGGCGGACTGAGGGG + Intronic
1002709219 5:181184167-181184189 CCGGGGCGAGGGACCCTGGGCGG + Intergenic
1004194007 6:13487786-13487808 GGCGGGCGAGGCGGCCTGGGCGG - Intergenic
1007408795 6:41649705-41649727 GCGGGGAATGGTGCCCTGGGTGG + Exonic
1011128797 6:84033894-84033916 GCGGGACAGGGCGCCCAGGGCGG + Intronic
1015644889 6:135376099-135376121 GCGGGGCGGGGCGCAGTGGTGGG + Intronic
1016597074 6:145814785-145814807 GCGGGGCGGGGCGCGCGAGGAGG - Intergenic
1016982085 6:149863412-149863434 CCGGGGCGAGGCGCGCGCGGTGG + Exonic
1017696560 6:157021606-157021628 GCGCGGCGCGGCGCCGTCGGAGG - Intronic
1017719799 6:157236362-157236384 GCGGGCCGAGGCGGGCTGTGGGG + Intergenic
1017891596 6:158644265-158644287 GCGGGGCGCGGCGGCCGGGCTGG - Intronic
1018013599 6:159693334-159693356 GCGGGGCGGGGCCCGCGGGGGGG - Intronic
1018020909 6:159761866-159761888 GCGGGGCGCGGGGCGCGGGGCGG - Exonic
1018400231 6:163414338-163414360 GCCGTGCGGGGCGCCCGGGGCGG - Intronic
1018828006 6:167422786-167422808 GCGGGGGGAGCCGCCGTGTGTGG - Intergenic
1018876644 6:167827272-167827294 GCGGGGCGCGGCGCAGCGGGCGG - Intronic
1019112170 6:169724687-169724709 GCGGGGCGGGGACCCCCGGGAGG - Intronic
1019497788 7:1348441-1348463 GCGGGGTGAGGGGCTCTGGGAGG - Intergenic
1019708921 7:2509612-2509634 GTGGGGCGGGCGGCCCTGGGGGG - Intergenic
1019739458 7:2665510-2665532 GCGGGGCCACGCTCGCTGGGTGG + Intergenic
1021668695 7:23013752-23013774 CCCGCGCGAGGCGCCATGGGTGG - Intronic
1023888953 7:44379370-44379392 GCGGGGCGGGGCGGGGTGGGGGG + Exonic
1023918303 7:44606928-44606950 GCGGAGCGACGCGCCATTGGCGG + Intronic
1026470934 7:70693966-70693988 GAGGGGCGGGGCGCGCGGGGCGG + Intronic
1026765018 7:73154959-73154981 GCGGCGCGCGGCGCCCGGCGCGG - Intergenic
1027041490 7:74964714-74964736 GCGGCGCGCGGCGCCCGGCGCGG - Intergenic
1027082152 7:75237655-75237677 GCGGCGCGCGGCGCCCGGCGCGG + Intergenic
1029419646 7:100466178-100466200 GCGGGGCGGGGGGCCCTGAATGG - Intronic
1030121150 7:106112082-106112104 GCTCGGCGCGGCGCCCTAGGCGG - Intronic
1035021997 7:155805691-155805713 CCGGGCCGGGACGCCCTGGGCGG - Intronic
1035717180 8:1763606-1763628 GCGGGGCGCGGCGCGGGGGGCGG - Intronic
1037417534 8:18667754-18667776 GCGGGGCAAGGAGCCCATGGCGG + Intronic
1038319436 8:26513968-26513990 GCGGGGCGCGGCGCCGGGGAGGG - Exonic
1038450041 8:27633967-27633989 GCGGCGCTAGGCGCCCGGCGGGG + Intronic
1038726037 8:30083191-30083213 GCGGGGCGAGGCGGTGTGGGCGG + Exonic
1039467918 8:37797137-37797159 GCGTGGAGGGGGGCCCTGGGCGG - Intronic
1039553323 8:38458942-38458964 GGGGGGCAAGGGGGCCTGGGAGG + Intronic
1039921304 8:41896247-41896269 GTGGGGCGCGGCGCCCGGTGCGG - Intronic
1042785196 8:72537791-72537813 GCGGGGAGAGGCTCCCCGGAGGG + Exonic
1045305411 8:100952688-100952710 GCGGGGCGGGGGCCCCGGGGCGG + Intronic
1047203174 8:122782726-122782748 GCGGGGCGGGGGGCCGAGGGCGG + Intronic
1047492396 8:125385828-125385850 GCGGGGCGGGGGGCCCTGGCCGG + Intergenic
1049181592 8:141225836-141225858 GCGGGTGGAGGTGCCCAGGGAGG - Intronic
1049509068 8:143018690-143018712 GCGGCGGAAGGCGCCCTGCGGGG + Intronic
1049665541 8:143841111-143841133 GCGGGGCGGGGCCTCCGGGGGGG - Intergenic
1051170317 9:14314328-14314350 GCGGGGCGAGGCGGGCGGGCGGG - Intronic
1051774922 9:20622568-20622590 GCGGGGCGGAGCGCGCGGGGAGG + Intergenic
1056406800 9:86282630-86282652 GCGGGGCAAGCCGCTCGGGGCGG + Intergenic
1057080452 9:92171091-92171113 GCTGGGGGAGGCGCCGGGGGCGG - Intergenic
1057900375 9:98943780-98943802 GCGTGGGGAGGCGGCCGGGGCGG + Exonic
1057995638 9:99820049-99820071 GCGGGGCAGGGCGCGCGGGGCGG - Intergenic
1060701022 9:125748268-125748290 CCGGGGCGAGGCTCCCCGCGCGG + Intronic
1060713073 9:125889909-125889931 GCGGGGCAGAGCGCCCTGAGCGG + Intronic
1060832021 9:126722941-126722963 GCGGGGGCGGGCGCCCCGGGGGG - Intergenic
1061237813 9:129352383-129352405 GCGGGAGGGGGCTCCCTGGGAGG + Intergenic
1061293519 9:129665560-129665582 GGCGGGCGAGGCGCGCGGGGAGG + Intergenic
1061409102 9:130408939-130408961 GCGGGGCCTGGCACCTTGGGTGG + Intronic
1062117146 9:134815606-134815628 GCGGGGCCAGGCTCTCCGGGGGG - Exonic
1062237153 9:135515746-135515768 GAAGGGCGAGGGACCCTGGGTGG + Intergenic
1062507558 9:136886020-136886042 GCGGGACGCGGGGCCCTGGCGGG - Intronic
1062615932 9:137395651-137395673 GGGGTGGGAGGGGCCCTGGGGGG + Intronic
1062646710 9:137551654-137551676 GCGGGGCGGGGCTCGCGGGGCGG - Exonic
1062646716 9:137551668-137551690 GCGGGGCGGGGCTCGCGGGGCGG - Exonic
1062646722 9:137551682-137551704 GCGGGGCGGGGCTCGCGGGGCGG - Exonic
1062646728 9:137551696-137551718 GCGGGGCGGGGCTCGCGGGGCGG - Exonic
1062646734 9:137551710-137551732 GCGGGGCGGGGCTCGCGGGGCGG - Exonic
1185476610 X:419321-419343 GCGTGGCGAGGTGCCCGGGGAGG - Intergenic
1187225824 X:17375084-17375106 GGGGGGCGCAGCGCCCTGTGCGG - Intergenic
1187281459 X:17860974-17860996 GCGGGGCCCGGCGCCCGGGGAGG - Intronic
1189262627 X:39689155-39689177 GCGGGGACCGGCGCCCTGAGGGG + Intergenic
1189267937 X:39730733-39730755 GTGGGGCGGGGCTTCCTGGGTGG + Intergenic
1190337381 X:49270448-49270470 GCGGGACGTAGCGCGCTGGGTGG - Exonic
1190526270 X:51332523-51332545 CCGGGGCGAGGGGCCAGGGGCGG - Intronic
1195086410 X:101418222-101418244 GCGGGGCGGGGCGCTGTGTGAGG - Intergenic
1196354333 X:114772471-114772493 GCGGGGCGGGGCGTGGTGGGGGG + Intronic
1198158589 X:133985679-133985701 GCGGGGCGAGGCGAGCCGCGCGG + Intronic
1200119072 X:153781920-153781942 GCAGGGCGGGGCTCCCTGAGGGG + Intronic
1200229446 X:154436861-154436883 GCGGGGCGGGGCGCGGCGGGTGG + Intergenic
1200229466 X:154436945-154436967 GCGGGGCGGGGCGGGCGGGGCGG - Exonic