ID: 1160913197

View in Genome Browser
Species Human (GRCh38)
Location 19:1484119-1484141
Sequence CGTGGTGACCTGAGGGCAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 199}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160913186_1160913197 20 Left 1160913186 19:1484076-1484098 CCGAGGTGCCCGTGTGCTGGTCT 0: 1
1: 0
2: 4
3: 20
4: 171
Right 1160913197 19:1484119-1484141 CGTGGTGACCTGAGGGCAGAGGG 0: 1
1: 0
2: 2
3: 17
4: 199
1160913191_1160913197 -8 Left 1160913191 19:1484104-1484126 CCCGTGATGCAGGTCCGTGGTGA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1160913197 19:1484119-1484141 CGTGGTGACCTGAGGGCAGAGGG 0: 1
1: 0
2: 2
3: 17
4: 199
1160913192_1160913197 -9 Left 1160913192 19:1484105-1484127 CCGTGATGCAGGTCCGTGGTGAC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1160913197 19:1484119-1484141 CGTGGTGACCTGAGGGCAGAGGG 0: 1
1: 0
2: 2
3: 17
4: 199
1160913187_1160913197 12 Left 1160913187 19:1484084-1484106 CCCGTGTGCTGGTCTGTGCACCC 0: 1
1: 0
2: 1
3: 29
4: 197
Right 1160913197 19:1484119-1484141 CGTGGTGACCTGAGGGCAGAGGG 0: 1
1: 0
2: 2
3: 17
4: 199
1160913188_1160913197 11 Left 1160913188 19:1484085-1484107 CCGTGTGCTGGTCTGTGCACCCG 0: 1
1: 0
2: 2
3: 22
4: 156
Right 1160913197 19:1484119-1484141 CGTGGTGACCTGAGGGCAGAGGG 0: 1
1: 0
2: 2
3: 17
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160913197 Original CRISPR CGTGGTGACCTGAGGGCAGA GGG Exonic
901927953 1:12578948-12578970 CTTGGTGGTCTGAGGGCAGATGG + Exonic
902036698 1:13463161-13463183 CCGGGTGTCCTGAAGGCAGAGGG + Intergenic
902278741 1:15359078-15359100 CCTGGGGACCTGATGGCATAGGG + Intronic
902301175 1:15503809-15503831 CGTGGAGAGCCTAGGGCAGAGGG + Intronic
903236103 1:21951724-21951746 CATGGAGCCCTGGGGGCAGAGGG - Intergenic
904450065 1:30605331-30605353 TGGGGTGAGCGGAGGGCAGAGGG + Intergenic
905004599 1:34699534-34699556 AGTGGAGACCAGAGTGCAGAGGG + Intergenic
905474149 1:38214006-38214028 AGTGGTGACCTGGGGCGAGAGGG + Intergenic
905478831 1:38247488-38247510 GCTGGTGACCGGAGGCCAGAGGG - Intergenic
905956595 1:42002420-42002442 CGAGGTGTCATGTGGGCAGATGG - Intronic
906606538 1:47176382-47176404 CTTGATGAGCTGAGGGCAGGTGG + Intergenic
907359939 1:53906294-53906316 GGTGGTGACCTGGGGACAGGGGG + Exonic
910438088 1:87226010-87226032 AGTGGAGACCTGAGGCAAGAGGG + Intergenic
913532479 1:119742793-119742815 GGTGGTGACCTGTGTGGAGAAGG - Exonic
914674656 1:149899506-149899528 CGTGGTGCCCTGAGGGCTCATGG - Exonic
914826009 1:151138398-151138420 CGAAGTTATCTGAGGGCAGAGGG + Exonic
915632591 1:157163759-157163781 TTTGCTGACCTGATGGCAGAAGG + Intergenic
915924366 1:160004777-160004799 CATGGTGTCCTCAGGGCACAAGG + Intergenic
919221153 1:194630061-194630083 TGTGGTTACCAAAGGGCAGAAGG - Intergenic
920299587 1:204980384-204980406 CCTGGTGACGTGAAGGGAGAGGG + Exonic
1069557373 10:69407039-69407061 AGTGGGGCCCTGAGGGCAGAGGG + Intronic
1069755926 10:70774468-70774490 CGAGGGGACCTGAGGGCAGAAGG - Intronic
1069987498 10:72294373-72294395 CCTGGTGTCCTGGGGACAGAGGG - Intergenic
1073430696 10:103484892-103484914 CATGGTGACCGTAGGACAGAAGG - Intergenic
1074687239 10:115972185-115972207 GGTGGAGACCTGGGGACAGAGGG + Intergenic
1075791140 10:125085097-125085119 GGTGGTGACGTGAGGGTTGAAGG - Intronic
1076641913 10:131923155-131923177 AGTGGTTACCAGAGGGCAGAGGG - Intronic
1076756880 10:132577194-132577216 CGTGGTGCCCTGAGTGCAGGTGG + Intronic
1077367736 11:2167925-2167947 CGAGAAGCCCTGAGGGCAGAGGG + Exonic
1077985415 11:7346816-7346838 AGTGGTTACTTTAGGGCAGAGGG - Intronic
1078369392 11:10732480-10732502 CATGGAGACATGAGGACAGAGGG - Intergenic
1083614107 11:64018058-64018080 GGGGGTGAGCTGGGGGCAGAGGG + Intronic
1084609289 11:70191907-70191929 CATGGAGACAGGAGGGCAGAGGG - Intergenic
1085051670 11:73383161-73383183 CGTGGTGACCTGGGAGCTCATGG + Intronic
1085509805 11:77082512-77082534 GGAGGTGACCTTGGGGCAGATGG + Intronic
1089302544 11:117507395-117507417 AGGGGTGCCCTGAGGGCGGAGGG - Intronic
1091651333 12:2312455-2312477 TGTGTTGATCTGAGGGCAGAAGG - Intronic
1091998674 12:5015863-5015885 CTGGCTCACCTGAGGGCAGAGGG - Intergenic
1096240800 12:49959177-49959199 TGTGATGACTTGAGGACAGAGGG + Intergenic
1097373669 12:58815330-58815352 AGTGGGGAACAGAGGGCAGATGG + Intergenic
1102465398 12:113127998-113128020 CCTGGGCACCTGAGGGGAGAGGG - Intronic
1103402140 12:120650311-120650333 CCTGGAGAGCTGATGGCAGAGGG - Intronic
1103937122 12:124482662-124482684 CTGGGTCACCTGAGGGCAGATGG + Intronic
1104053104 12:125209458-125209480 CCTGGTCACCTCAGGGGAGAAGG + Intronic
1104679468 12:130739605-130739627 ACTGCTGGCCTGAGGGCAGAGGG - Intergenic
1104967158 12:132513535-132513557 AGAGGTGACCAGAGGGCTGATGG - Intronic
1106028208 13:25974926-25974948 GGTGGTGGGCTGAGGGCAGAAGG - Intronic
1107965851 13:45597618-45597640 CCTGGTGAGCTGAGGGCAGATGG - Intronic
1107993434 13:45838543-45838565 CGTGGTGGCCTGGGGGCACTTGG - Intronic
1109278493 13:60328723-60328745 CATGGTGCCCTCAGGGAAGACGG + Intergenic
1110805520 13:79750014-79750036 TGTGGTGTCCTGAAGTCAGATGG - Intergenic
1112208500 13:97348932-97348954 GGTGATTACCTCAGGGCAGATGG - Intronic
1113739663 13:112702486-112702508 CCTGGCCATCTGAGGGCAGAGGG - Intronic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1117517205 14:56513545-56513567 CGTGGTTTCCTGTGGGCAGTGGG + Intronic
1119364914 14:74083872-74083894 CGTGGTGATCTGAGGTAAGGGGG - Intronic
1119477297 14:74938389-74938411 CATGGTGACCTCAGGGTAGTTGG + Intergenic
1119835826 14:77747878-77747900 CGGGGTGGCCTCTGGGCAGAGGG - Intronic
1122299156 14:100722329-100722351 AGAGGGGACCTGGGGGCAGAGGG - Intergenic
1122744182 14:103888314-103888336 CGTGGGGACCTGAGGTCAGGAGG - Intergenic
1122895836 14:104756507-104756529 CATGCATACCTGAGGGCAGAGGG - Intronic
1123024787 14:105419616-105419638 CCTGGTGCCCTGGGGGTAGAGGG - Intronic
1125399601 15:39286855-39286877 CATGGGGACATGAGGGGAGAAGG - Intergenic
1125596819 15:40892881-40892903 AGTCCAGACCTGAGGGCAGATGG + Intergenic
1125766737 15:42141403-42141425 CGAGGAGACCAGAAGGCAGAAGG + Exonic
1129466321 15:75726127-75726149 CATGGGGACCTGCGGGCAGCTGG - Exonic
1130379904 15:83362654-83362676 TGGGGTGACTGGAGGGCAGAGGG - Intergenic
1130727318 15:86452736-86452758 CGTGAGGAGATGAGGGCAGAAGG - Intronic
1132726483 16:1341115-1341137 CGTGGGGGCCTGTGGACAGAGGG - Exonic
1135060463 16:19267064-19267086 GGAGGTGACCTGAGGGCTGCAGG + Exonic
1135548570 16:23381327-23381349 CGAGGTGCCCTGATGGCGGAAGG + Intergenic
1136011804 16:27368300-27368322 TGTGGTCACCAGAGGGCAGCAGG - Intergenic
1136537987 16:30911483-30911505 GGTGGTAACCTGGAGGCAGAGGG + Intergenic
1140562905 16:76004688-76004710 CTTGGTGAGCTGAGGGCACAAGG + Intergenic
1142066548 16:88066096-88066118 CGAGGCGGCCTCAGGGCAGACGG + Intronic
1142515251 17:423599-423621 CTAGGTGACATGAGGACAGAAGG - Intronic
1142695168 17:1629250-1629272 CGTGGTGACCCGCGCGCAGGGGG - Intergenic
1142977625 17:3655313-3655335 CATGATCACCTGAGGGTAGAAGG - Exonic
1143845696 17:9771517-9771539 CGTGGTGGCCTGTGGGGTGAAGG - Exonic
1144399907 17:14886309-14886331 CCTGCTGACCTGAGTGCATAGGG - Intergenic
1144623254 17:16831667-16831689 CATGGTGGGCTGGGGGCAGAGGG - Intergenic
1144765111 17:17728341-17728363 CTTGGAGACCAGAGGGAAGACGG - Intronic
1144883177 17:18441049-18441071 CATGGTGGGCTGGGGGCAGAGGG + Intergenic
1145149053 17:20503337-20503359 CATGGTGGGCTGGGGGCAGAGGG - Intergenic
1146569903 17:33943305-33943327 AGTGCGGACATGAGGGCAGATGG - Intronic
1147577577 17:41611604-41611626 CATGGTGGGCTGGGGGCAGAGGG - Intronic
1148691317 17:49528491-49528513 AGGGGTGGCCTGAGGGAAGAGGG + Intergenic
1148764507 17:50029265-50029287 GGAGGTGACCAGAGGGCAGAGGG - Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150965829 17:69967421-69967443 GGCGGTGACCTGAGGTCAGGCGG + Intergenic
1151483327 17:74383266-74383288 GGAGGAGACCTGGGGGCAGAGGG + Intergenic
1151764096 17:76123141-76123163 CCTGGGCCCCTGAGGGCAGAGGG + Intergenic
1152148916 17:78586811-78586833 CGTGGTGACCTGAAGGGAGTTGG + Intergenic
1152357238 17:79813258-79813280 GGCGGTTACCTGCGGGCAGAGGG - Intergenic
1152790040 17:82273810-82273832 CGGGGTAACAGGAGGGCAGAGGG - Intergenic
1152807289 17:82362149-82362171 CATGCTGACCGGAGGGCACATGG - Exonic
1154194990 18:12258946-12258968 CCTGGTGACCCGGGGGGAGAGGG - Intronic
1154356817 18:13627837-13627859 AGCGGTGGCCAGAGGGCAGACGG + Intronic
1156391280 18:36652736-36652758 GGGGGTGACAGGAGGGCAGATGG - Exonic
1157307193 18:46525834-46525856 TGTGGGGTCCTGGGGGCAGAGGG - Intronic
1157558941 18:48632646-48632668 CGTGGCCAGCTTAGGGCAGATGG - Intronic
1158505728 18:58044568-58044590 CGGGGGGACCTGGAGGCAGAGGG + Exonic
1158588630 18:58761968-58761990 CGTGCTGACCTGCTGGAAGATGG + Intergenic
1160048545 18:75409794-75409816 CCTGAGGACCTGAGTGCAGATGG - Exonic
1160178852 18:76617485-76617507 CACTGTGTCCTGAGGGCAGAGGG + Intergenic
1160662325 19:306841-306863 CGGGGTGCCCTGAGGGGAGCTGG + Intronic
1160732376 19:647114-647136 CGTGGGGACCTGCGGGCTCAGGG - Intergenic
1160913197 19:1484119-1484141 CGTGGTGACCTGAGGGCAGAGGG + Exonic
1161185045 19:2912080-2912102 AGTGGTGAGATGTGGGCAGAGGG + Intronic
1162311813 19:9912597-9912619 CGTGGTGTCCTGAGGAGAGAGGG - Intronic
1163989541 19:20985675-20985697 CTTGGTGACCTGTGGACAAAGGG - Intergenic
1165061378 19:33206833-33206855 CAGGGTGACCTGAGGGCCCATGG + Intronic
1165244885 19:34493173-34493195 AGTGGAGACCTGAGGCCAGGAGG + Intronic
1165466592 19:35978527-35978549 CGTGGTGAAGTGAGGGAGGAGGG - Intergenic
1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG + Intronic
1168102107 19:54146779-54146801 AGTGCTGCCCTGAGGGCAGGTGG + Intronic
1168690462 19:58373611-58373633 GGTCAAGACCTGAGGGCAGAAGG - Intronic
925817609 2:7768843-7768865 CCAGGGGACCTGAGGGCACAGGG - Intergenic
928868867 2:35950964-35950986 GATGGTGACATGAGGGCACATGG + Intergenic
930337264 2:50064857-50064879 CTTTGTAACATGAGGGCAGAGGG + Intronic
930891440 2:56392891-56392913 TCTGGTAACCTGAGGGCAGTAGG + Intergenic
932815913 2:74861587-74861609 CAAGGTCACCTGTGGGCAGATGG + Intronic
935205128 2:100890509-100890531 CCTGATGACCTGAGGGTACAGGG - Intronic
936264503 2:110992492-110992514 GGTGGGGACCTGAGGAAAGATGG + Intronic
936397668 2:112141480-112141502 CGTGGTGATGTTAGTGCAGAAGG + Intronic
936918218 2:117661585-117661607 CCTGGGGACCCGAGGGAAGAGGG + Intergenic
938542520 2:132296291-132296313 CATGGTGACATGAAGGCATATGG - Intergenic
944028094 2:195196516-195196538 CGTGCTTACCAAAGGGCAGAAGG - Intergenic
944770691 2:202911624-202911646 AGAGGAGACCGGAGGGCAGAAGG - Exonic
945781899 2:214185776-214185798 TGTGGAGACCAGAGAGCAGAGGG + Intronic
945821337 2:214669492-214669514 AGTGGTGATATGAGGGGAGAAGG + Intergenic
948824372 2:240567179-240567201 CGTGGGGACCTGAGGTCCTACGG + Intronic
948858296 2:240740828-240740850 CCTGGTGCCCTGGGGGCAGCTGG - Intronic
949042848 2:241857516-241857538 CGGGGGAACCAGAGGGCAGAGGG - Intronic
1171370009 20:24656437-24656459 CGTGGTGCCCTGAGGAAAGCAGG + Intronic
1171458472 20:25285167-25285189 CGTGGTGCCCACACGGCAGAGGG - Intronic
1171564913 20:26172856-26172878 CCTGGTGGCCTCATGGCAGAGGG - Intergenic
1171871401 20:30529138-30529160 CATGGTGACATGAAGGCATATGG - Intergenic
1172362633 20:34324741-34324763 TGAAGTGAGCTGAGGGCAGAGGG + Intergenic
1172884612 20:38222752-38222774 CGTGGTGACGAGAGGGGACATGG - Intronic
1173926436 20:46784672-46784694 CCTGGTGACCTGAGGGAGGGAGG + Intergenic
1174340051 20:49889946-49889968 CCTGGTGACGAGGGGGCAGACGG - Exonic
1175385537 20:58592630-58592652 CGGGGTGAGATGAGGGAAGATGG + Intergenic
1175557464 20:59878193-59878215 CCTGGTGGCCTGAGGCCACATGG - Intronic
1175709826 20:61210503-61210525 CATGGGATCCTGAGGGCAGATGG + Intergenic
1179229380 21:39487841-39487863 CCTGGTGACCTGAAGGAGGAAGG + Intronic
1180912690 22:19463713-19463735 TGGGTTGCCCTGAGGGCAGATGG - Intronic
1181311347 22:21946526-21946548 CGTGGTGACCAGATGGCAGGAGG + Intronic
1184795338 22:46728855-46728877 CAGGGTGTGCTGAGGGCAGAGGG + Intronic
1185076843 22:48687732-48687754 GGAGGTGACCTGAGGCCAGCAGG - Intronic
949858731 3:8486118-8486140 CTTGGTGAACTCAGGGCAAAGGG + Intergenic
950679880 3:14577840-14577862 CATGATGACATCAGGGCAGAGGG - Intergenic
951714582 3:25626736-25626758 AGTGGTGACCTGGGGAAAGAAGG - Intronic
953301974 3:41786505-41786527 GGTGGTCACCTGAGCCCAGAAGG + Intronic
954634106 3:52062360-52062382 CTTGGTGACCTCATGGGAGATGG - Intergenic
955344271 3:58149535-58149557 CTTGGAGGCGTGAGGGCAGAAGG + Intronic
957469323 3:80638272-80638294 CCTGGGAACCTGAGGGGAGAGGG - Intergenic
961451894 3:127005920-127005942 CCTGGTCACCTGGGGGCTGAGGG + Intronic
961667924 3:128505148-128505170 CATGGTGGCCTCAGGGCAGTTGG - Intergenic
962342082 3:134594303-134594325 GCTGGTGGCATGAGGGCAGAGGG - Intergenic
962432849 3:135336061-135336083 TGTGGGGTCCTGAGGGGAGAGGG - Intergenic
962954344 3:140250355-140250377 CATGGTGAAATGGGGGCAGATGG + Intronic
966431028 3:179831856-179831878 AGTGTAGACCTGAAGGCAGAAGG + Intronic
966963167 3:184961558-184961580 GGTGGAGACCTCAGGGGAGAGGG - Intronic
967846417 3:194046634-194046656 CCTGGTGGCCTCAGGGCAGTTGG + Intergenic
968423660 4:506338-506360 CATCGTGCCCTGAGGGCAGGTGG + Intronic
968483149 4:845692-845714 GGAGGTGGCCTGAGGGCAGCTGG + Intergenic
970483922 4:16505721-16505743 TGTGGGGAGCTGAGGGCATATGG - Intronic
971986227 4:33828734-33828756 CATGGTGGCCTCATGGCAGAGGG + Intergenic
973319915 4:48799556-48799578 GGTGGTCACCTAAGGGAAGATGG + Intergenic
973566048 4:52188657-52188679 CAGGGCTACCTGAGGGCAGAGGG - Intergenic
979853009 4:125596376-125596398 AGAGGTGACATGAGTGCAGAAGG + Intergenic
985494698 5:197975-197997 GGGGGTGACCTGGGGGCAGCTGG - Exonic
985981937 5:3477338-3477360 CGGGGTCCCCTGAGGGCAGCTGG + Intergenic
991422003 5:66451641-66451663 GGTGGTGCCCTGTGAGCAGAGGG + Intergenic
993211281 5:84955515-84955537 AGTTGTGACCTATGGGCAGATGG - Intergenic
996029305 5:118687169-118687191 TGCAGTGACCTGAGAGCAGAGGG + Intergenic
998415961 5:141946158-141946180 AGTGGAGCCCTGAGGGGAGAAGG - Intronic
1001565506 5:172696941-172696963 CGTGGGAAACTGCGGGCAGATGG - Intergenic
1002433494 5:179217858-179217880 GGGGATGGCCTGAGGGCAGACGG + Intronic
1002433503 5:179217896-179217918 GGGGATGGCCTGAGGGCAGACGG + Intronic
1003148976 6:3532625-3532647 AGTGGTGACAAGAGGGCTGAGGG - Intergenic
1003577261 6:7308986-7309008 CGTGGTGACATGAGTCTAGAAGG - Intronic
1003816923 6:9851650-9851672 TGTGGTGATCTGGGTGCAGACGG + Intronic
1005969377 6:30749297-30749319 CATGGTGATCTGGGGGAAGATGG - Intergenic
1005994482 6:30922998-30923020 CGGGGTGAGCAGAGGGCAGCGGG + Intronic
1006297834 6:33177921-33177943 CGTGGTGCCCTGAGGGCTCTGGG - Intronic
1007483178 6:42163289-42163311 CTTGGGGACCTGAGGTCACAGGG - Exonic
1007555460 6:42762036-42762058 CGTGGTGACTGGAAGGCAGAAGG - Intronic
1007953510 6:45895092-45895114 GGTGGTTATCTGTGGGCAGAAGG + Intergenic
1008564057 6:52749995-52750017 CAAGGTGGCCTGAGAGCAGAGGG + Intergenic
1008572822 6:52831269-52831291 CAGGGTGGCCTGAGAGCAGAGGG + Intergenic
1008579769 6:52896235-52896257 CAGGGTGGCCTGAGAGCAGAGGG + Intronic
1011124015 6:83986995-83987017 CCAGGTGAGATGAGGGCAGATGG - Intergenic
1017180569 6:151547930-151547952 CATGGTGACTTGACTGCAGAAGG + Intronic
1017991711 6:159494826-159494848 GGTGGGGAGCTGAGGACAGATGG - Intergenic
1019997143 7:4731930-4731952 CATGGAGACCTGAGGCCACACGG + Intronic
1034348532 7:150401939-150401961 GGTGGTGAGCAGAGGGGAGAAGG - Intronic
1036238653 8:7064407-7064429 CCTGGTGACCTGCAGGAAGATGG + Intergenic
1038600958 8:28942003-28942025 TGGGGTGGCCTGAGGGCGGATGG - Intronic
1039894223 8:41704912-41704934 GGTGCTGAGATGAGGGCAGATGG + Intronic
1042879853 8:73475096-73475118 AGTGGTGACCTTTGGGGAGAGGG + Intronic
1043087184 8:75849507-75849529 CGTGAGGACCTGAAGGCAGGGGG - Intergenic
1045098725 8:98825324-98825346 CGAGGGGACCTGAGGGGAGCGGG - Intronic
1045490213 8:102662492-102662514 CGTGGTGAAATGCTGGCAGAGGG + Intergenic
1048277516 8:133078017-133078039 AGTGCTGCCCTGAGGGCAGTTGG + Intronic
1054452532 9:65410921-65410943 CTAGGTGACCTGAGGGCTGAAGG - Intergenic
1056447935 9:86684371-86684393 CATGCTGACCTGAGGCCAGCTGG - Intergenic
1059537366 9:115093911-115093933 CATGGTGGTCTGAGGGCAGTGGG + Intronic
1061881555 9:133571587-133571609 CGTGGGGCCCAGAAGGCAGAGGG - Intronic
1062137823 9:134938989-134939011 CGTGGTGGCCGCAGGGGAGAGGG - Intergenic
1062139107 9:134945666-134945688 CCTGGAGAGCGGAGGGCAGAGGG + Intergenic
1062333196 9:136053509-136053531 AGTGGGGACCTGAGGGTGGAGGG - Intronic
1185506383 X:634592-634614 CGTGGGGAGCGGAGGGCACAGGG - Intronic
1190427460 X:50346329-50346351 CGTGGTTCTCAGAGGGCAGATGG + Intronic
1190817244 X:53939308-53939330 GGAGGTGGCCTGAGGGCAGTTGG - Intronic
1191216132 X:57933969-57933991 CGTGGGGACCTTAGAGCAGCTGG + Intergenic
1191779359 X:64849364-64849386 AGAGGTGACCTGAGGGGTGATGG - Intergenic
1198175039 X:134146592-134146614 GGTGGAGCTCTGAGGGCAGAGGG - Intergenic