ID: 1160917322

View in Genome Browser
Species Human (GRCh38)
Location 19:1503482-1503504
Sequence CTGGCTCATGAGGCTACTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160917322_1160917330 20 Left 1160917322 19:1503482-1503504 CCGACAGTAGCCTCATGAGCCAG No data
Right 1160917330 19:1503525-1503547 CGAGAGGGCCCCGCGTCCAATGG No data
1160917322_1160917328 5 Left 1160917322 19:1503482-1503504 CCGACAGTAGCCTCATGAGCCAG No data
Right 1160917328 19:1503510-1503532 TCACGAGGAGGCCTGCGAGAGGG No data
1160917322_1160917327 4 Left 1160917322 19:1503482-1503504 CCGACAGTAGCCTCATGAGCCAG No data
Right 1160917327 19:1503509-1503531 GTCACGAGGAGGCCTGCGAGAGG No data
1160917322_1160917325 -7 Left 1160917322 19:1503482-1503504 CCGACAGTAGCCTCATGAGCCAG No data
Right 1160917325 19:1503498-1503520 GAGCCAGTGCTGTCACGAGGAGG No data
1160917322_1160917324 -10 Left 1160917322 19:1503482-1503504 CCGACAGTAGCCTCATGAGCCAG No data
Right 1160917324 19:1503495-1503517 CATGAGCCAGTGCTGTCACGAGG No data
1160917322_1160917331 21 Left 1160917322 19:1503482-1503504 CCGACAGTAGCCTCATGAGCCAG No data
Right 1160917331 19:1503526-1503548 GAGAGGGCCCCGCGTCCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160917322 Original CRISPR CTGGCTCATGAGGCTACTGT CGG (reversed) Intergenic
No off target data available for this crispr