ID: 1160917325

View in Genome Browser
Species Human (GRCh38)
Location 19:1503498-1503520
Sequence GAGCCAGTGCTGTCACGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160917322_1160917325 -7 Left 1160917322 19:1503482-1503504 CCGACAGTAGCCTCATGAGCCAG No data
Right 1160917325 19:1503498-1503520 GAGCCAGTGCTGTCACGAGGAGG No data
1160917321_1160917325 3 Left 1160917321 19:1503472-1503494 CCGGCAGGCACCGACAGTAGCCT No data
Right 1160917325 19:1503498-1503520 GAGCCAGTGCTGTCACGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160917325 Original CRISPR GAGCCAGTGCTGTCACGAGG AGG Intergenic
No off target data available for this crispr