ID: 1160918890

View in Genome Browser
Species Human (GRCh38)
Location 19:1510629-1510651
Sequence GGCGCTGCCTCCGGTGAGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 137}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160918890_1160918896 7 Left 1160918890 19:1510629-1510651 CCCCGCTCACCGGAGGCAGCGCC 0: 1
1: 0
2: 1
3: 6
4: 137
Right 1160918896 19:1510659-1510681 CACAGAGACGCCACGCCCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 82
1160918890_1160918899 21 Left 1160918890 19:1510629-1510651 CCCCGCTCACCGGAGGCAGCGCC 0: 1
1: 0
2: 1
3: 6
4: 137
Right 1160918899 19:1510673-1510695 GCCCGCAGGAGCTGGAGCAGCGG 0: 1
1: 0
2: 2
3: 60
4: 471
1160918890_1160918901 22 Left 1160918890 19:1510629-1510651 CCCCGCTCACCGGAGGCAGCGCC 0: 1
1: 0
2: 1
3: 6
4: 137
Right 1160918901 19:1510674-1510696 CCCGCAGGAGCTGGAGCAGCGGG 0: 1
1: 0
2: 16
3: 133
4: 868
1160918890_1160918903 28 Left 1160918890 19:1510629-1510651 CCCCGCTCACCGGAGGCAGCGCC 0: 1
1: 0
2: 1
3: 6
4: 137
Right 1160918903 19:1510680-1510702 GGAGCTGGAGCAGCGGGTCCAGG 0: 1
1: 0
2: 3
3: 66
4: 553
1160918890_1160918897 13 Left 1160918890 19:1510629-1510651 CCCCGCTCACCGGAGGCAGCGCC 0: 1
1: 0
2: 1
3: 6
4: 137
Right 1160918897 19:1510665-1510687 GACGCCACGCCCGCAGGAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160918890 Original CRISPR GGCGCTGCCTCCGGTGAGCG GGG (reversed) Exonic
900403846 1:2483881-2483903 GGCGCTGACTCCCGTGTGGGGGG + Intronic
900403854 1:2483903-2483925 GGCGCTGACTCCCGTGTGGGGGG + Intronic
900403860 1:2483925-2483947 GGCGCTGACTCCCGTGTGGGTGG + Intronic
900403867 1:2483946-2483968 GGCGCTGACTCCCGTGTGGGGGG + Intronic
900403875 1:2483968-2483990 GGCGCTGACTCCCGTGTGGGGGG + Intronic
900403883 1:2483990-2484012 GGCGCTGACTCCCGTGTGGGGGG + Intronic
900403889 1:2484012-2484034 GGCGCTGACTCCCGTGTGGGTGG + Intronic
900403894 1:2484033-2484055 GGCGCTGACTCCCGTGTGGGTGG + Intronic
900482874 1:2907866-2907888 GGTGGGCCCTCCGGTGAGCGAGG + Intergenic
900482883 1:2907893-2907915 GGTGGGCCCTCCGGTGAGCGAGG + Intergenic
901434269 1:9236583-9236605 CGCCCTGCCTCCGGTGACGGAGG + Intronic
901877419 1:12174906-12174928 TGCGCTGTCTCCGGTCAGAGTGG - Intronic
905182655 1:36176492-36176514 TGCGCCCCCGCCGGTGAGCGCGG + Exonic
905714096 1:40133215-40133237 TGCGCTGCCCCAGGGGAGCGAGG + Intergenic
905924016 1:41737092-41737114 GGCACTCCCACTGGTGAGCGGGG - Intronic
909592727 1:77370108-77370130 GGAGCTGCCTGCTGTGAGCCTGG + Intronic
912391734 1:109307501-109307523 CCCGCTGCCCCCGGGGAGCGGGG - Intergenic
913047944 1:115089532-115089554 GGCGGGGCCTCCGGGGGGCGGGG + Intergenic
914251667 1:145927008-145927030 GGCTTTGGCTCCGGTGAGTGTGG - Intergenic
915490014 1:156245654-156245676 GGCGCAGCCTGCGGTGAGGTGGG + Exonic
915646030 1:157273376-157273398 GGCACTGCCTCCTCTGAGTGTGG - Intergenic
915647000 1:157279461-157279483 GGCGCTACCTCCTCTGAGTGTGG - Intergenic
917504757 1:175617431-175617453 GGCACTGGCTCCAGTCAGCGGGG + Intronic
922574162 1:226651264-226651286 GGCGAGGCCTCGGGAGAGCGTGG + Intronic
1068883599 10:62076081-62076103 GATGCTGCTTCCGGTGAGCCCGG + Intronic
1076145612 10:128117440-128117462 GGCGCTGTCTCTGGGGAGCCAGG - Intronic
1077018519 11:407293-407315 GGCGGGGCCTCGGGTGGGCGGGG + Intronic
1077322190 11:1947450-1947472 CGCGCGGACTCCGGGGAGCGGGG + Intronic
1083741501 11:64713783-64713805 GGCGCTCCCCGCGCTGAGCGGGG + Exonic
1084180494 11:67443394-67443416 CCCGGTGCCCCCGGTGAGCGCGG - Exonic
1084758331 11:71252599-71252621 GGAGCTGGCTCCGGCGAGGGTGG + Intergenic
1090375136 11:126283059-126283081 GGCGGCGCTTCCGGAGAGCGGGG + Intronic
1090608803 11:128451884-128451906 CGGGCTGCCCCCGCTGAGCGGGG - Intergenic
1090923816 11:131232120-131232142 GACGCTGACTCCCGTGAGCTTGG + Intergenic
1202805208 11_KI270721v1_random:2763-2785 CGCGCGGACTCCGGGGAGCGGGG + Intergenic
1091915344 12:4269235-4269257 GGCGCTGGCTCCGGGGTCCGCGG + Intergenic
1102136942 12:110583205-110583227 CGCTCTGGCTCCGGTGCGCGCGG - Exonic
1102248355 12:111369042-111369064 GGCGCAGCCGCGGGAGAGCGCGG + Exonic
1103014668 12:117484658-117484680 GGCCCTGCCTCTGTTGAGTGTGG - Intronic
1103954247 12:124567581-124567603 GCCGCGGCCGCCGGGGAGCGCGG - Intronic
1104127426 12:125861484-125861506 GGGTCTGAATCCGGTGAGCGCGG + Intergenic
1104379182 12:128291916-128291938 GAAGCTGCCTCCGGTCAGCCGGG - Intronic
1104926710 12:132317685-132317707 GGCGCAGCCTCTACTGAGCGAGG - Intronic
1106717552 13:32406845-32406867 GGTTCTGCCTCTGGTGAGCCGGG - Intronic
1107851402 13:44576510-44576532 GGCGCTGCCTCCGTGCAGAGCGG - Exonic
1113566986 13:111325192-111325214 GGCGCTGCCTCAGGATGGCGGGG - Intronic
1121737549 14:96228892-96228914 GGCCCTGCCTCTGATGAGCAGGG + Intronic
1126837150 15:52679077-52679099 GCGGCTGCCTCAGGTGACCGTGG + Intronic
1127631003 15:60827652-60827674 GGAGCTGCCTCCTGGGAGAGAGG + Intronic
1128622482 15:69161555-69161577 GGCGCTGGGTCCGCTGAGGGCGG + Intronic
1129440565 15:75578560-75578582 GGCGCGGTCGCCGGTGAGGGAGG + Intronic
1130739838 15:86587385-86587407 GGTGCTGCCACAGGTGAGCTCGG - Intronic
1131513790 15:93064401-93064423 GGCGCTGCCTCTAGTGACCCTGG + Intronic
1132027785 15:98417652-98417674 GGCTCTGCCTCTGGTGAGCGAGG - Intergenic
1132464771 16:72441-72463 GGGGCTGCGTCCGGAGGGCGGGG - Intronic
1132544876 16:528336-528358 GAGGCCGCCTCCGGTGTGCGCGG - Intronic
1132813951 16:1817156-1817178 GGCGCTGCCTACTGTGTCCGGGG + Exonic
1132900622 16:2251981-2252003 GGGGCTGCCTGGGGTGAGCCCGG + Intronic
1133006253 16:2883329-2883351 GGCGCTGTCGCCGGAGAGGGAGG + Exonic
1136613450 16:31380937-31380959 GGAGCTGCCTACGATGAGGGGGG - Exonic
1137262762 16:46844504-46844526 GGCGCTGCCCCAGCTGAACGCGG - Intergenic
1137371166 16:47907174-47907196 TTTGCTGTCTCCGGTGAGCGCGG + Intergenic
1141635988 16:85314158-85314180 GGCACTGCCTCAGGGGAGGGAGG - Intergenic
1143108074 17:4539289-4539311 GGCGCTGCCACTGGGGAGGGTGG - Intronic
1147253118 17:39165468-39165490 GCCGCTGGCTCCGTTTAGCGGGG + Intronic
1148090345 17:45019433-45019455 GGCGCTGCCTCCCGCGGGCCGGG - Intergenic
1148388643 17:47254242-47254264 CGCGCAGCCCCGGGTGAGCGCGG - Intronic
1151487942 17:74413604-74413626 AGCTCTGCCTCCAGTGAGCGAGG - Intergenic
1152178637 17:78803827-78803849 GGCGCTGCCTCAGGTCAACGAGG - Exonic
1152789027 17:82268313-82268335 GGGGGTGCCCCCGGTGGGCGAGG - Intronic
1153622191 18:6989772-6989794 GGCACTGCCTCCAGAGTGCGTGG - Intronic
1155507984 18:26549767-26549789 TGCGCTGCCTCAGGCGCGCGGGG + Intronic
1158604971 18:58887691-58887713 GACGGTCCCTCCTGTGAGCGTGG - Intronic
1160766878 19:812710-812732 GGGGCTGCCCCCGCTGGGCGCGG - Exonic
1160810598 19:1011357-1011379 GGCATTGGCTGCGGTGAGCGTGG - Exonic
1160918890 19:1510629-1510651 GGCGCTGCCTCCGGTGAGCGGGG - Exonic
1160955728 19:1690962-1690984 GGCGCTGCCTTGTGTGGGCGTGG - Intergenic
1161170162 19:2808488-2808510 GGGGCTGCCTGTGGTCAGCGAGG + Intronic
1162480237 19:10923371-10923393 GTCGCTGCCTCCGGAGAACGTGG - Exonic
1162892991 19:13747630-13747652 CGCGCTGCAGCCGGTCAGCGAGG - Intronic
1164658562 19:29942415-29942437 GGCGCGGCCTCCTGGGCGCGGGG + Exonic
1166250339 19:41565227-41565249 GGCGGTGCCACAGGGGAGCGGGG - Intronic
1166510652 19:43406639-43406661 AGCGCTGCCCCTGGTGAGCTTGG - Intronic
1166554622 19:43689994-43690016 GGCCCTGCCTCTGGTGGGAGTGG - Intergenic
1167501965 19:49853531-49853553 GGCGCGGCTTGCAGTGAGCGAGG + Intronic
932201080 2:69829279-69829301 GGCGTGGCCTCCTGTGAGAGGGG - Intergenic
934754639 2:96816619-96816641 GGCGCTGCTGGCGGTGCGCGTGG + Exonic
935645310 2:105329615-105329637 GGCGCCGGCGCCGGTGAGTGAGG - Exonic
936397455 2:112140361-112140383 GGTGCTGCCTCCCCTGCGCGCGG - Intronic
938336984 2:130509431-130509453 GGCCCTTCCTCGGGTGGGCGTGG - Exonic
938352857 2:130611315-130611337 GGCCCTTCCTCGGGTGGGCGTGG + Intergenic
948098858 2:235358074-235358096 GGCGCTGCAGCCGTGGAGCGAGG - Intergenic
948463038 2:238139354-238139376 GGCGCTGGCCCCGGTGAAGGCGG - Intronic
948890868 2:240906517-240906539 AGCTCTGCCTCCAGTGAGCCTGG + Intergenic
1169042697 20:2508871-2508893 CACGCTGGCTCTGGTGAGCGCGG - Exonic
1169183857 20:3595125-3595147 GGCCCTGCCTCCACTGAGCAAGG + Intronic
1170566569 20:17611272-17611294 GGCCCTGCCTCAGGTGGGCCGGG - Intergenic
1172983452 20:38962522-38962544 GGCGCTGCCGCCTCTGTGCGGGG + Intronic
1175191775 20:57216487-57216509 GGCGCTGTCTCCTGAGGGCGAGG + Intronic
1176229436 20:64024517-64024539 GGCCCTGCCTCTGGTGACCGTGG + Intronic
1179937914 21:44616731-44616753 TGCGCTGCCTGCGCTGAGCCAGG - Intronic
1180788115 22:18558238-18558260 GGCCCTGCCTGCGTTGGGCGGGG - Intergenic
1180926576 22:19559350-19559372 GGAGCTGGCCCAGGTGAGCGTGG - Intergenic
1180965260 22:19784804-19784826 GCCGCTGCCTCCGGTGCAGGTGG - Exonic
1181233623 22:21437080-21437102 GGCCCTGCCTGCGTTGGGCGGGG + Intronic
1181245027 22:21497763-21497785 GGCCCTGCCTGCGTTGGGCGGGG - Intergenic
1183486198 22:38088942-38088964 GGCGCTGCCGCTGTAGAGCGAGG + Exonic
1184049613 22:41994702-41994724 AGGCCTCCCTCCGGTGAGCGTGG + Exonic
1184568862 22:45309850-45309872 GGCGGGGCCTCCGGGGACCGCGG + Intronic
1185214479 22:49590598-49590620 GGGGCTGCTTCCTGAGAGCGCGG - Intronic
953886650 3:46717905-46717927 GCCGCGGCCTCTGGTGAGCTGGG + Exonic
954867816 3:53744550-53744572 GGTGCTGCCTCGTGTGGGCGGGG + Intronic
968622179 4:1608743-1608765 GGCTCTCCCTCCGGCGAGCAGGG - Intergenic
968745614 4:2358465-2358487 GGCCCTGCCTCCAGTTAGCGGGG + Intronic
977536539 4:98261321-98261343 GGCGCAGCCTGCGGCGGGCGCGG - Intergenic
977666554 4:99651475-99651497 GGCGCTGCCACCGGCCAGCTTGG + Exonic
978106143 4:104904247-104904269 GGAGCTGCCTCCTGTGAACAAGG + Intergenic
978777338 4:112516672-112516694 GGAGCGGGCTCCGGTGCGCGTGG - Intergenic
996058926 5:119011371-119011393 AGCCCTGCGTCGGGTGAGCGGGG + Intergenic
1002342242 5:178524675-178524697 AGCCCTGCCTCGGGTCAGCGTGG - Intronic
1003948240 6:11094256-11094278 GGCGCGGACGGCGGTGAGCGCGG - Exonic
1004396206 6:15248389-15248411 GGCGCGGCCTGCGGGGCGCGGGG + Intronic
1007965274 6:45998709-45998731 GGAGCTGCCTTCAGTGAGAGTGG - Intronic
1014066613 6:117134388-117134410 GGTGCTGGCTCCAGTGAGCTGGG + Intergenic
1019410456 7:904516-904538 GGGGCTGCCCCCGGGGAGGGAGG - Intronic
1023855092 7:44178052-44178074 GGCCCTGCCTGTGGGGAGCGGGG + Intronic
1035290451 7:157834711-157834733 GGCCCAGCCTCCAGTGAGCCTGG + Intronic
1041281141 8:56211714-56211736 CGGGCTGCCGCCGGGGAGCGGGG + Intronic
1042542915 8:69924771-69924793 AGAGCTGACTCCGCTGAGCGAGG + Intergenic
1043476638 8:80611650-80611672 GGCGCCTCCTCCGGTGCACGGGG + Intergenic
1047960821 8:130010532-130010554 GGGGCTGCCTTCAGGGAGCGGGG - Intronic
1048576055 8:135690734-135690756 GGGGCTGCCAGCGGTGCGCGCGG - Intergenic
1049375871 8:142288862-142288884 GGCTGTGCCTCCTGTGAGAGGGG + Intronic
1049389717 8:142361462-142361484 GGCGCTGCCTCCCAGGAGCGAGG + Intronic
1049471607 8:142777351-142777373 GGCGGGGCCTGCGGTGAGCTCGG - Intronic
1049471624 8:142777404-142777426 GGCGGGGCCTGCAGTGAGCGCGG - Intronic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1052358576 9:27529677-27529699 GACTCTGCCGCCGGTGCGCGAGG + Exonic
1055611683 9:78031306-78031328 ACCGCTGCCTCGGGGGAGCGAGG - Exonic
1057921908 9:99104907-99104929 GGCCCAGCCCCCGGGGAGCGTGG + Intronic
1060828612 9:126700310-126700332 GGCGCTGCATCAGATGAGCAGGG + Exonic
1060945956 9:127569280-127569302 TCCGCTGCCTCCGGCGGGCGGGG + Intronic
1061262580 9:129488374-129488396 GCGGCTGCCTCCGGAGCGCGGGG + Intergenic
1061413558 9:130433540-130433562 CGCGCTGCGTCCGCTGCGCGCGG + Exonic
1062572793 9:137193343-137193365 GGGGCTGCCTCCACTGAGCCTGG + Intronic