ID: 1160922135

View in Genome Browser
Species Human (GRCh38)
Location 19:1526006-1526028
Sequence TGGGCATGGGTGAGTCCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160922135_1160922146 14 Left 1160922135 19:1526006-1526028 CCCCTTGGACTCACCCATGCCCA 0: 1
1: 0
2: 1
3: 17
4: 200
Right 1160922146 19:1526043-1526065 CATGCCCCTGTGCCTACCTGTGG 0: 1
1: 0
2: 1
3: 19
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160922135 Original CRISPR TGGGCATGGGTGAGTCCAAG GGG (reversed) Intronic
900154006 1:1196847-1196869 TGGGGATGGGTGTATCCATGAGG + Intronic
900488119 1:2933139-2933161 TGGGCAAGGGTGTGCCCCAGAGG - Intergenic
901097274 1:6692359-6692381 GGGGCAGGGGTGGGCCCAAGAGG - Intronic
901873624 1:12153230-12153252 TGGGCGTGGATGAGTCACAGTGG - Intergenic
902221784 1:14970797-14970819 TGGGCGTGGGTGAGTGCTAGAGG - Intronic
902718801 1:18290799-18290821 TAGGGACGGGTGACTCCAAGGGG - Intronic
903314716 1:22493639-22493661 AGGGCATGGGTAAGTGGAAGGGG - Intronic
903964020 1:27074767-27074789 GGGTCATGGGTGACTCCAGGAGG - Intergenic
904986075 1:34549828-34549850 TAGCCATGGGTGAGTGCATGTGG - Intergenic
915277306 1:154798186-154798208 TGTGTCTTGGTGAGTCCAAGAGG - Intronic
917966623 1:180182982-180183004 TGGGCCAGGGTGAGGCCAAGTGG - Intronic
920503077 1:206497610-206497632 TGGGGAAGGGTGAGTCCTGGAGG + Exonic
921367818 1:214390804-214390826 TGGGCATGGATGGGTCCAAGGGG + Intronic
1062949515 10:1487473-1487495 AGGGCATGGGTGAGCCCACAGGG - Intronic
1065074854 10:22067019-22067041 GGGGGATGGGTGGGTCTAAGAGG - Intergenic
1069828932 10:71270992-71271014 TGGGCATGTGTGTGTCTGAGGGG + Intronic
1070986397 10:80693412-80693434 TTGGCATGGGTGAGGCCAGTGGG + Intergenic
1071334054 10:84587232-84587254 TGGGCATGGCTGAGTGTCAGAGG + Intergenic
1073324079 10:102632489-102632511 TGGGCATTGGTGCCTCCCAGAGG + Exonic
1076439109 10:130467417-130467439 TGGGCTTGGGTGAGTGATAGGGG + Intergenic
1077108723 11:852936-852958 AGGGCATGGGGGAGCCCCAGTGG + Intronic
1079122832 11:17697335-17697357 AGGGCCAGGGTGAGGCCAAGAGG - Intergenic
1079182419 11:18205053-18205075 TGGGTGTGGGTGAGTGCCAGTGG - Intronic
1080638117 11:34141038-34141060 TGGGCAAGGGCGTGTCCTAGAGG + Intronic
1080645019 11:34181942-34181964 TGAGAAAGGGTGAGTCCAGGGGG - Intronic
1081456801 11:43231602-43231624 TGGCCATGGGTGATACCATGGGG + Intergenic
1083006593 11:59352108-59352130 GGGGAATGGGTGAGTTGAAGTGG - Intergenic
1083592226 11:63902561-63902583 TGGGAATGGGTAAGGCCAAGGGG - Intronic
1083882474 11:65555368-65555390 AGGGCATGGATGAGGCCAGGAGG - Intronic
1084598650 11:70132109-70132131 TGGGCAGTGGTGAGTCTGAGTGG + Intronic
1085395051 11:76202957-76202979 TCAGCATGTGTGAGGCCAAGGGG - Intronic
1085511592 11:77090938-77090960 TGGGGATGGATGAGACCAGGCGG + Intronic
1087108329 11:94434381-94434403 TGGGTATGGTTGAGTCTGAGAGG - Intronic
1087150682 11:94856779-94856801 TGGGAAGTGGTGAGTCCATGCGG - Intronic
1087329086 11:96756675-96756697 TGGAGATGGGAGAGGCCAAGTGG + Intergenic
1091220870 11:133929454-133929476 TGGGCATGGCTGTGTCCCTGTGG - Intronic
1096806965 12:54146853-54146875 TGGGTATGGGTGAGTGGCAGAGG - Intergenic
1100382976 12:94078982-94079004 TGGGAATGGGTGAGACCACCCGG + Intergenic
1100615262 12:96226496-96226518 TGGGCATGGGTGTGCACATGTGG - Intronic
1100615269 12:96226548-96226570 TGGGCATGGGTGTGCACATGTGG - Intronic
1100664046 12:96731009-96731031 TGGGCATGGGGGTGTACATGAGG + Intronic
1102017330 12:109656603-109656625 GGGGCATGGGTGGGTGGAAGGGG - Intergenic
1102790056 12:115637371-115637393 TGGGCATGGCTGACACCAAAGGG - Intergenic
1103221829 12:119252747-119252769 TGGGCATGGGTGAGAGCTGGAGG + Intergenic
1104412980 12:128574694-128574716 TGGGCTTGGGTGGTTCCAAGTGG + Intronic
1104558825 12:129825561-129825583 TGGGCTTGGGAGAGTGCAGGTGG - Intronic
1104765865 12:131329809-131329831 AGGGGAGGGGTGAGTACAAGAGG + Intergenic
1104813402 12:131632053-131632075 AGGGGAGGGGTGAGTACAAGAGG - Intergenic
1105024528 12:132839379-132839401 TGTGCAGGGGTGAGGCCAAGAGG - Intronic
1105024535 12:132839414-132839436 TGTGCAGGGGTGAGGCCGAGGGG - Intronic
1105024576 12:132839559-132839581 TGTGCAGGGGTGAGGCCAAGAGG - Intronic
1106045993 13:26142701-26142723 TAGACATGGGGGACTCCAAGAGG + Intronic
1110379248 13:74831024-74831046 TTCTCATGGATGAGTCCAAGGGG + Intergenic
1113834446 13:113319527-113319549 TGGGCACGGGTGAGGGCGAGGGG - Exonic
1114210428 14:20609492-20609514 TGGGCATGGGTGACACCTAGTGG + Intronic
1116493837 14:45536974-45536996 TGGGCTTTGGAGAGTCCAAATGG - Intergenic
1116798567 14:49418062-49418084 TGGGGAGGGGTGAATTCAAGAGG - Intergenic
1117660874 14:58003259-58003281 GGTGCATGGCTGGGTCCAAGTGG + Exonic
1118555825 14:67019972-67019994 TGGGCTTGTGTGTGTACAAGTGG + Intronic
1120827306 14:88967603-88967625 TGGGGATTGGTGGGCCCAAGTGG - Intergenic
1121359731 14:93245725-93245747 TGGGCACTGCTGAGTCCCAGTGG + Intronic
1122107003 14:99465559-99465581 TGGGCCTGGGCGAGTCACAGAGG - Intronic
1125333546 15:38605365-38605387 TGTGCATGTGTGCGTGCAAGAGG + Intergenic
1128365073 15:66993921-66993943 TGGTCATGGGGCAGTCCATGGGG + Intergenic
1128507573 15:68286464-68286486 TGTGTGTGTGTGAGTCCAAGAGG - Intronic
1130839239 15:87682325-87682347 TGGGTATGGGTGTTTCCATGAGG - Intergenic
1131446988 15:92507272-92507294 TGTGCATGTGTGAGGGCAAGGGG + Intergenic
1131938488 15:97534372-97534394 TGGGCATGTGTTAGGCCCAGAGG + Intergenic
1133006099 16:2882669-2882691 TGGGCACGGGTGGGCCCAATGGG + Intergenic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1137456321 16:48620771-48620793 TGGGAGTGGGAGAGTTCAAGGGG - Intergenic
1137719911 16:50621886-50621908 TGGGCAGCGGTGAGTCCCTGGGG - Intronic
1139528467 16:67530214-67530236 TGGCCAGGGCTGAGTCCGAGCGG - Intronic
1140038560 16:71390042-71390064 TGGGCAGGGGTGGGTGCAGGGGG - Exonic
1141336794 16:83163521-83163543 TGGACATGGGTGAGTGCCAATGG - Intronic
1141624105 16:85252487-85252509 TGGGCTTGGGTGTGCCCAAGGGG - Intergenic
1141755364 16:85987469-85987491 TGGCCATGTGGGAGTCCAGGAGG + Intergenic
1141755761 16:85989544-85989566 TGGCCATGCGGGAGTCCAGGAGG + Intergenic
1143356298 17:6331242-6331264 TAGGCATGGTGGGGTCCAAGAGG + Intergenic
1143504340 17:7355634-7355656 GGGTCATGGGTGAGGTCAAGGGG + Exonic
1143854603 17:9839456-9839478 TGGGCTTGGGTGGGGCCAGGTGG - Intronic
1144511081 17:15877476-15877498 GGGGAATGGATGAGCCCAAGAGG - Intergenic
1145119679 17:20246470-20246492 TGGCCAGGGGTGCCTCCAAGAGG - Intronic
1145123531 17:20281676-20281698 TGAGCCTGGGTGACTCCAGGAGG + Intronic
1145175241 17:20695163-20695185 GGGGAATGGATGAGCCCAAGAGG - Intergenic
1147426098 17:40346611-40346633 GGGGCCTGGGTGAGGCCAGGAGG - Intronic
1147746381 17:42697324-42697346 AGGCCTTGGGTGAGTCCAACTGG - Exonic
1148434745 17:47674727-47674749 TGGGTCTGGGGGAGTACAAGAGG + Exonic
1149464753 17:56868496-56868518 TGGGCAGGGGAAAGTGCAAGAGG - Exonic
1149640026 17:58196803-58196825 TGAGCCTGGGTGAGTCAAGGAGG + Intronic
1152739040 17:82011129-82011151 TGGGCATGGGTGGGGCAGAGGGG + Intronic
1155201816 18:23524346-23524368 TGGGCAGGGGCGAGTGCTAGCGG + Intronic
1155364595 18:25036960-25036982 TGGGGATGGTGCAGTCCAAGTGG + Intergenic
1155464487 18:26120228-26120250 TGGGCTTTGGAGAGTCCAAATGG + Intergenic
1158875736 18:61733057-61733079 AGAGCAGGGGTGAGGCCAAGAGG - Intergenic
1159437020 18:68431469-68431491 TGGGCGTGGGTATGCCCAAGAGG - Intergenic
1160922135 19:1526006-1526028 TGGGCATGGGTGAGTCCAAGGGG - Intronic
1161241705 19:3226645-3226667 TGGGAATGGGGGAGTCCACATGG + Intronic
1161724270 19:5919286-5919308 GGGGCTTGGCTGAGTCCACGGGG - Intronic
1162924633 19:13924056-13924078 AGGGCCTGGGTGAGTCCACGGGG + Intronic
1163349291 19:16765184-16765206 GAGGCATGGGTGAGTCCAGATGG + Exonic
1163534929 19:17871741-17871763 TGGGGATGGGTGGGTGCATGGGG + Intergenic
1163831711 19:19550288-19550310 TGATGATGGGTGAGTCAAAGGGG - Intergenic
1165353420 19:35289869-35289891 TGGGCAGGGGTGAATACAGGGGG + Intergenic
1165787280 19:38469264-38469286 TGGGCAGGGGTGAGGGCAGGTGG - Intronic
1166768438 19:45266018-45266040 TGGGCATGGGGGTGTCCTGGGGG + Intronic
1167473519 19:49687963-49687985 TGGGCTTGGGGGTGTCCATGTGG + Intronic
1168138042 19:54364757-54364779 TGGGCCTAGGTGAGTCCTGGAGG - Exonic
1168159833 19:54502944-54502966 TGGGCCTAGGTGAGTCCTGGAGG + Exonic
925134085 2:1514518-1514540 TGGGCAAGGGGGAGTCCCTGAGG - Intronic
925943462 2:8840281-8840303 GGGGTATGGGTGAGTCCAGTGGG - Intergenic
926808285 2:16733478-16733500 TGGGAAGGGGTGAGTCCAACAGG + Intergenic
927863630 2:26575566-26575588 TGGGGATGGCCAAGTCCAAGGGG - Intronic
928067133 2:28175784-28175806 TTGGCATTAGTGAGTCCAAGTGG - Intronic
928911013 2:36420824-36420846 TGGGGTTGGTTGAGTCCAGGTGG + Intronic
929413761 2:41726568-41726590 TGGGCATGCGTGTGTCTCAGAGG - Intergenic
929868797 2:45740526-45740548 GGGGGAAGGGTGCGTCCAAGTGG - Intronic
931462133 2:62458244-62458266 TGGGCATAGGTGTGTCCGTGAGG + Intergenic
936316322 2:111427530-111427552 TGGGCAAGGGTGTGTCCAGAGGG + Intergenic
936862026 2:117030019-117030041 TGGGCTTTGGAGAGTCTAAGCGG + Intergenic
937267746 2:120627436-120627458 TGGACATAGGTGAGGCCATGTGG - Intergenic
938565994 2:132519651-132519673 GGGGCATGGGGGAGTACATGAGG + Intronic
938789136 2:134661093-134661115 TAAGCATGTGTGAGTGCAAGAGG - Intronic
938809701 2:134842014-134842036 TGGGCATGTATGAATCAAAGTGG - Intronic
939283003 2:140089396-140089418 TGGGCATAGGTAAGTTCAACAGG - Intergenic
942937111 2:181570885-181570907 TGTGAATGGGTGAGTCCAAATGG - Intronic
944287990 2:197973751-197973773 TGGGCAGGCGTGAGGTCAAGTGG + Intronic
946521561 2:220470126-220470148 TGGTCAAGGGTGGGACCAAGTGG + Intergenic
946786139 2:223246344-223246366 TGGGCTTTGGAGAGTCCAGGTGG - Intergenic
947286731 2:228525073-228525095 GGGGCTTTGGTGAGTCCATGTGG - Intergenic
948589535 2:239040249-239040271 AGGGCAGGGCTGAGTCCATGGGG - Intergenic
1169195783 20:3681471-3681493 TGGGCATGGGGGCTTCCTAGAGG + Intronic
1171163863 20:22953499-22953521 TGGGCATGGGTAAGGGCCAGCGG + Intergenic
1172015020 20:31868408-31868430 AGGGCTTGGGTGACTCAAAGTGG - Intronic
1172872979 20:38147309-38147331 TGGGCAGGGGTGAGACCAGAAGG - Intronic
1173140982 20:40482642-40482664 TGGGCATGGCTGAATCCAGGTGG - Intergenic
1173330879 20:42075435-42075457 AAGACATGGGTGAGCCCAAGAGG - Exonic
1174061437 20:47835684-47835706 TGAGCAAGGTTAAGTCCAAGTGG - Intergenic
1174580331 20:51566899-51566921 TGGGCATGGCTCAGGCTAAGTGG + Intergenic
1175708099 20:61196225-61196247 TGGCCATGGGTGAGACAATGGGG + Intergenic
1175757580 20:61539230-61539252 TGGGGCTGGGTGAGACCCAGAGG - Intronic
1176240768 20:64074917-64074939 TGGGCATGGGTGGGTGGAGGAGG - Intronic
1178631349 21:34264061-34264083 TGGACATGGGTGAGGCTCAGTGG - Intergenic
1182328403 22:29531800-29531822 GGGGCCTGGGTGAGGACAAGGGG - Intronic
1184888702 22:47366468-47366490 TGGGGTTGGGGGAGTCCCAGGGG + Intergenic
1185251067 22:49801975-49801997 TGGGCATGGATGTGGCCAAACGG - Intronic
950555314 3:13692232-13692254 TGTGCATGTGTGAGTGTAAGGGG + Intergenic
959067838 3:101676374-101676396 TGGCCCTGGGTGGGACCAAGGGG - Intronic
960524385 3:118692668-118692690 AGGGAATGGGTGATTCTAAGGGG + Intergenic
960984649 3:123268154-123268176 TGGGTATGGGTGGGTCACAGGGG + Intronic
961452270 3:127007735-127007757 TGATCATGGGTGACTCCACGTGG + Intronic
962413082 3:135158448-135158470 TGGGCATGGCTGGGTTCCAGTGG + Intronic
962813740 3:138980191-138980213 TGTGCATGGGTTAGTAAAAGGGG + Intergenic
967189530 3:186973519-186973541 TGGGCAAGGGTGAGATGAAGTGG - Intronic
968041471 3:195592732-195592754 TGGACATGGCTCAGTCCAAGAGG - Intergenic
969502778 4:7563500-7563522 GTGGCATGGAAGAGTCCAAGTGG - Intronic
969714726 4:8863006-8863028 TGGGGATCGGCGAGTCCAGGAGG + Intronic
970268803 4:14320559-14320581 TCGGCATGGGTGTGACGAAGAGG + Intergenic
971202324 4:24522038-24522060 TGGGCAGGATTGAGACCAAGAGG - Intronic
971479565 4:27102241-27102263 TGGGGAAGGATGAGTCGAAGAGG - Intergenic
973757705 4:54091893-54091915 TGCGCATGCGTGAGTGTAAGTGG - Intronic
974582019 4:63815136-63815158 GGGGGATGGGTGAGTTGAAGTGG - Intergenic
979949475 4:126874527-126874549 TGGGCATGCAGGAGCCCAAGGGG + Intergenic
981053091 4:140331089-140331111 TGGGCAATGGTGGCTCCAAGGGG + Intronic
981154042 4:141413073-141413095 TGGGCAGGGGTGAATGGAAGTGG - Intergenic
981593266 4:146389142-146389164 TGGACATGGGAGACTCCAAAAGG + Intronic
982042635 4:151410211-151410233 TGTGAATGGGTGGGTCCAGGAGG - Intronic
987065627 5:14286906-14286928 TGGACATGCGTGGGTCCAAGTGG + Exonic
987416029 5:17663032-17663054 TGGGCTTTGGAGAGTCCAAATGG - Intergenic
988344253 5:30017863-30017885 TGGGCTCGGGTGGGTCCAAAAGG - Intergenic
988528729 5:32008939-32008961 TGGGCAAGGAAGAGTCCAAAGGG + Intronic
988934831 5:36071432-36071454 GGGGCATGAGTGAGTGAAAGAGG + Intergenic
997227879 5:132223023-132223045 GGGAGATGGGTGAGACCAAGAGG - Intronic
1000890460 5:166795654-166795676 TGGGAATGGGAGAGTCCATTTGG - Intergenic
1002799925 6:512678-512700 AGGGCATGGGTCAGACCACGGGG - Intronic
1004899384 6:20180370-20180392 AGGGCAAGGGTGAGTGGAAGTGG - Intronic
1007617194 6:43187087-43187109 TGGGCACAGGTGAGCCTAAGAGG + Exonic
1007684202 6:43655655-43655677 TTGACATGGGTGGGTCCAAAAGG - Exonic
1008160913 6:48074349-48074371 TGGGCATGGGCAAGGCCGAGAGG - Intergenic
1012437606 6:99231037-99231059 TGGTCATGAGTGAGTCCCAGGGG - Intergenic
1018474744 6:164129695-164129717 TGGAGATGCGTGACTCCAAGGGG - Intergenic
1019487106 7:1294394-1294416 TGGGCAGGGGTGTGACCAGGAGG - Intergenic
1019623162 7:2002420-2002442 TGGACAGGGGTGGGCCCAAGAGG + Intronic
1023839102 7:44085915-44085937 AGGACTTGGGTGTGTCCAAGAGG + Intergenic
1023912678 7:44566904-44566926 TTGGCCTGGGGGAGTCCATGGGG - Intronic
1024024957 7:45402105-45402127 TGTGCATGGCTGTGTCCAATTGG - Intergenic
1024984773 7:55185516-55185538 TGGGCATGGGAGGCTCCACGGGG - Intronic
1028912601 7:96225201-96225223 TGGCCATGGGTGAGAGGAAGGGG - Intronic
1030518713 7:110569605-110569627 TGGGCATGAGAGAGTCCACCTGG - Intergenic
1032500358 7:132395282-132395304 TTGGCATGGCTGAGGACAAGGGG + Intronic
1034117396 7:148596210-148596232 TGTGCATGTGTGAGGGCAAGAGG - Intronic
1035243103 7:157544923-157544945 TGTGCATGGGTGTGTACAGGTGG + Intronic
1037537192 8:19835740-19835762 TGGGCATAGGTGGGTTCTAGAGG + Intronic
1037754873 8:21704198-21704220 TGGGCATCGGTCAGTTGAAGAGG - Intronic
1038260958 8:25993505-25993527 TGGGCATGGCTCAGACCAGGAGG - Intronic
1038481864 8:27907416-27907438 TGTGCATGGGAGGGTCCATGTGG - Intronic
1039306641 8:36270299-36270321 TGGGCATGGGTGATTCCTTCTGG - Intergenic
1041972671 8:63761190-63761212 TGGGCTTTGGAGAGTTCAAGCGG - Intergenic
1047621962 8:126617062-126617084 TGGCCATGGGTCAGTCCAAAAGG + Intergenic
1049400357 8:142423967-142423989 AGGGCAGGGGTGGGTCCAGGAGG + Intergenic
1049587682 8:143439724-143439746 GGGGCCTGGGTGAGTCCCACGGG - Intronic
1049604019 8:143520833-143520855 TGGGCAGGGGTGGGCCCTAGTGG - Intronic
1051221428 9:14852252-14852274 TGGGCATTGGGGATTGCAAGTGG + Intronic
1053173009 9:35904457-35904479 TGAGTCTGGGTGATTCCAAGGGG + Intergenic
1056190613 9:84180836-84180858 TGGGCAAGGGTCAGGGCAAGAGG + Intergenic
1057197530 9:93123194-93123216 TGGGGAGGGGTGAGGCCAGGTGG + Intronic
1057909266 9:99005252-99005274 TGGGGATGGGTGAGTTGCAGAGG + Intronic
1058934424 9:109755128-109755150 TGGGGATGGGTGAGTGAGAGAGG - Intronic
1059952384 9:119479423-119479445 TATGCATGCGTGAGGCCAAGGGG + Intergenic
1060933887 9:127505058-127505080 TGGGTGATGGTGAGTCCAAGAGG - Intergenic
1061492956 9:130956366-130956388 TGGGCAGGGGTGAGGCGAGGAGG + Intergenic
1186099424 X:6139794-6139816 AGGCCTTGGGTGAGTCTAAGTGG - Intronic
1190296305 X:49029845-49029867 TGGGCAAGGATGAGTCCCACAGG + Exonic
1192170898 X:68854115-68854137 TGGGGAGGGGTCATTCCAAGTGG - Intergenic
1193790345 X:85808844-85808866 TGGGAATGGGTGAGTTGAACTGG - Intergenic
1198506509 X:137306787-137306809 TGGGCAAAGGTGAGTCCAGCTGG + Intergenic
1199094804 X:143726308-143726330 TGGCCATGCGGGAGTCCATGGGG + Intergenic
1200108404 X:153726650-153726672 TGGGCATGACTCAGCCCAAGCGG + Intronic
1202238747 Y:22743492-22743514 TGTGCATGTGTGAGTTCACGAGG + Intergenic