ID: 1160928816

View in Genome Browser
Species Human (GRCh38)
Location 19:1560133-1560155
Sequence CTGTGAAAGGGGAAGGTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160928808_1160928816 17 Left 1160928808 19:1560093-1560115 CCCTCGGCACTTGGGGGACCTTG 0: 1
1: 0
2: 0
3: 7
4: 66
Right 1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG 0: 1
1: 0
2: 0
3: 21
4: 233
1160928810_1160928816 -1 Left 1160928810 19:1560111-1560133 CCTTGCTATGCCTGTTTCTTCAC 0: 1
1: 0
2: 2
3: 44
4: 390
Right 1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG 0: 1
1: 0
2: 0
3: 21
4: 233
1160928809_1160928816 16 Left 1160928809 19:1560094-1560116 CCTCGGCACTTGGGGGACCTTGC 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG 0: 1
1: 0
2: 0
3: 21
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160928816 Original CRISPR CTGTGAAAGGGGAAGGTAAC AGG Intronic
901244171 1:7715590-7715612 CTGTGAAAGGGGGATGTGGCTGG - Intronic
902385155 1:16072222-16072244 CTGGGGAAGGGGAAGGTACAGGG - Intronic
902561871 1:17282705-17282727 CTGTGCAATGAGAAGGTAACTGG - Intronic
903355633 1:22745660-22745682 CTCTGAAAGGGGGTGGTCACAGG + Intronic
904351587 1:29910587-29910609 CTATAAAAGGGGATGGTAATAGG + Intergenic
904481320 1:30795551-30795573 CTGTAAAATGGGAATGTAATAGG - Intergenic
905532050 1:38687584-38687606 CTGTGTAAGGAGAGGGTAAGGGG - Intergenic
907459117 1:54594707-54594729 CTGTGCATGGGGAGGGTAGCTGG + Intronic
908179291 1:61588245-61588267 CTGTTACATGGGAAGGTAACAGG - Intergenic
909149787 1:71987417-71987439 CTGTGGAAGGGGTAGGTGAAGGG + Intronic
909586517 1:77295126-77295148 CTGTGAAAGGTGATTCTAACTGG - Intronic
910144669 1:84065591-84065613 TTGTGAAATGGGAATATAACAGG + Intergenic
911951008 1:104173169-104173191 GTGTGAAAGGGGACGGGAGCAGG - Intergenic
912510002 1:110182929-110182951 ATGAGAAATGGGATGGTAACTGG + Intronic
912727100 1:112068132-112068154 CTGAGGAAGGGAAAGGAAACTGG + Intergenic
916600717 1:166290719-166290741 ATGTGAAAGGGGAAGGGGTCTGG + Intergenic
919425929 1:197430447-197430469 CAGAGAAATGGGATGGTAACTGG - Intronic
919971345 1:202581463-202581485 CTTTGAAGGGGGAAGATAAGTGG - Exonic
920059977 1:203220533-203220555 CTGTGACGGGAGAAGGTACCCGG + Intronic
922795951 1:228339919-228339941 CTGTGAAGGGGGATGGCATCAGG - Intronic
1063313387 10:4978119-4978141 CTGGGAAAGGGGCAGGTGACAGG + Exonic
1063314565 10:4989598-4989620 CTGGGAAAGGGGCAGGTGACAGG - Exonic
1063338979 10:5245050-5245072 CAGTGACAGCGGAAGGTAAGGGG - Intergenic
1063344119 10:5295317-5295339 CAGTGACAGCGGAAGGTAAGGGG + Intergenic
1064294146 10:14062855-14062877 CAGTGAAAGGGGAAGATACATGG + Intronic
1065138112 10:22692564-22692586 CTGTGAAAGGGGTAGGCACTTGG + Intronic
1065514803 10:26514651-26514673 CTGTAAAAGGGAAAGGTGTCTGG - Intronic
1065853126 10:29807447-29807469 CTGTGGCTGGAGAAGGTAACCGG - Intergenic
1065974595 10:30831102-30831124 CTGTGAAAGAGAAAGAAAACTGG - Intronic
1067145087 10:43688889-43688911 CTGGGAAAGGGGGAGGTTGCTGG + Intergenic
1068297006 10:55084122-55084144 CTGGGAAAAAGGAAGGAAACTGG + Intronic
1070642151 10:78177863-78177885 CTTTGAGAGGGGAAGACAACTGG + Intergenic
1072381233 10:94873073-94873095 CAGTGAAAGGAGAAGCAAACAGG + Intergenic
1073574846 10:104613773-104613795 CTCTGAAAGGGGAATGTTAGAGG + Intergenic
1075841755 10:125510596-125510618 CAGTCAAAGAGGAAGGTAAAAGG - Intergenic
1076024776 10:127102281-127102303 CCGTGAAAGGGGATAGTAATAGG + Intronic
1076188041 10:128464135-128464157 CTCTGACAGGGGAAGGGACCAGG - Intergenic
1077872330 11:6272321-6272343 CTGTGAATGGGGATGGAAAATGG + Intergenic
1077922720 11:6653981-6654003 CTGGGAGGGAGGAAGGTAACAGG + Intronic
1078002826 11:7511903-7511925 CTGTGAAATAGGTAGGTAATAGG - Intergenic
1078575056 11:12494302-12494324 ATGAGAAAGGGGAAGGAAGCTGG - Intronic
1081114666 11:39185101-39185123 CTCTGAAAGGGGGATGAAACAGG + Intergenic
1081994032 11:47352306-47352328 CTGTGGAAGGTGAAGGCAATGGG + Intronic
1084561360 11:69907287-69907309 AGGTGGAAGGGGCAGGTAACTGG + Intergenic
1089634522 11:119803800-119803822 CTTTGAAGGAGGAAGGTGACAGG - Intergenic
1091670679 12:2450015-2450037 CTATGAAAGGCGAAGATGACAGG + Intronic
1091671426 12:2454797-2454819 ACGTGAAAGGGGAAGGAGACGGG - Intronic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1093711840 12:22336192-22336214 CTGGAAAAGGGGAAGGGAAGGGG + Intronic
1094111792 12:26870121-26870143 ATGGGAAACGGGAAGGAAACAGG + Intergenic
1095330611 12:40957337-40957359 CTGGGAGAGGTGAAGGTTACTGG + Intronic
1096786334 12:54019089-54019111 CTGCGAAAGGGGAATTTAGCGGG - Intronic
1098077575 12:66749385-66749407 CTGAGAAAAGGCAAGTTAACTGG - Intronic
1099493868 12:83320395-83320417 GAGAGAAAGAGGAAGGTAACTGG - Intergenic
1102009969 12:109612173-109612195 CTGTCAAATGGGGTGGTAACAGG + Intergenic
1102548109 12:113671200-113671222 GTGTGAAAAGGGAAAGTGACTGG - Intergenic
1103400353 12:120639707-120639729 ATGTGCAGGGGGAAGGGAACTGG + Intergenic
1106497472 13:30293711-30293733 CTGTGTAGGGAGAAGGGAACAGG - Intronic
1111767594 13:92552468-92552490 CTTTGTAAGGGGAAGATAAATGG + Intronic
1113458544 13:110465859-110465881 CTTTGAAATGGGCAGGGAACGGG - Intronic
1114816485 14:25964918-25964940 CTGTGAAAGGGAAAGTTGAAGGG - Intergenic
1114851876 14:26391972-26391994 CAGTGAAATGGGAAGCTCACTGG - Intergenic
1116290181 14:43024426-43024448 GTGGGAAAGGGGAAGGAAATCGG + Intergenic
1118629423 14:67689216-67689238 CTGTGAGATGGGAAGGAAACTGG - Intronic
1119826803 14:77663539-77663561 CTGTGTTAGGTGAATGTAACAGG - Intergenic
1120431327 14:84419369-84419391 CTGTGCAAGGAGAAAGTAGCAGG - Intergenic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1122203296 14:100135684-100135706 CTGGGGAAGGGGAAGGCTACAGG - Intronic
1123971976 15:25515839-25515861 CTGTGAATGGGGAGGGTGATGGG + Intergenic
1125412168 15:39416832-39416854 CTATGAAAGGGGAAGAACACAGG - Intergenic
1125764286 15:42122924-42122946 CTGTGAATGAGGAAGGAAAGGGG - Intergenic
1127903517 15:63358988-63359010 CTGAGAAAGGGCAGGGAAACGGG - Intronic
1129411297 15:75352007-75352029 GGGTGCAAGGGGAAGGAAACTGG - Intronic
1131967764 15:97862633-97862655 TTGTGAAGGGGGCAGGTAAGAGG - Intergenic
1132152783 15:99474394-99474416 AAGTGAAAGGGGAAGGGAAGGGG + Intergenic
1133267475 16:4593757-4593779 CTGTGACATGGGATGGTACCAGG - Intronic
1134596575 16:15500527-15500549 TTGAGGAAGGGGAAGGTATCAGG + Intronic
1136116795 16:28099616-28099638 CTGTGAAATGGGGGAGTAACAGG + Intronic
1137324395 16:47419565-47419587 CCGTGAAAGTGCAAGGGAACAGG - Intronic
1138263377 16:55641691-55641713 CTGTAAAAGGGGAAGATACTGGG + Intergenic
1141473787 16:84258219-84258241 CTGTGAGAGGGGAAGCCAGCTGG + Intergenic
1141477007 16:84280794-84280816 CTGTGAAAGCAGAAGGGAAAAGG - Intergenic
1142560304 17:805470-805492 CCCTGAAAGGCGAAGGTGACAGG - Intronic
1144105349 17:11979658-11979680 ATGTGAAAGAGAAAGGTAAATGG - Intronic
1144847818 17:18229203-18229225 CTGTGAAAGGGGCAGGGGAGCGG + Intronic
1146140482 17:30363603-30363625 CTTTGAGAGGTGAAGGTAAGAGG + Intergenic
1146394307 17:32450683-32450705 GTATGAAAGTGGAAGGAAACAGG + Intronic
1146560575 17:33865331-33865353 TTGTGAAAAAGGAAGGAAACAGG - Intronic
1146959355 17:36959927-36959949 GTATGAAATGGGAAGATAACAGG - Intronic
1148020490 17:44549969-44549991 CTGTGACGGGGGAAGGTGAAAGG + Intergenic
1151106520 17:71622399-71622421 CTGTGACAGGAGATGGAAACTGG - Intergenic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1153407105 18:4753277-4753299 GTGTGAAAGGGGACCCTAACAGG + Intergenic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1153946647 18:10023823-10023845 CTGTGAGAGGGGAGGGCCACTGG + Intergenic
1156160312 18:34350980-34351002 CTCTGGAAGGGGAAGCTAATGGG + Intergenic
1156950172 18:42886567-42886589 CTTAGAAAAGTGAAGGTAACTGG + Intronic
1157879589 18:51307915-51307937 CAGTGGAAGGGGAAGCAAACAGG + Intergenic
1158359748 18:56658559-56658581 ATGTGAAAACAGAAGGTAACTGG - Intronic
1159463715 18:68752407-68752429 CAGGGAAAGGGGAAGGGAAAAGG + Intronic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1162388487 19:10375259-10375281 CTGGGAATGGGGGAGGTAAGAGG + Intronic
1163282991 19:16328404-16328426 CTGAGAATGGGGAAGGTGAGGGG - Intergenic
1165302498 19:34979615-34979637 CAGTGATAGGGGAATGCAACTGG - Intergenic
1165637573 19:37355102-37355124 CTGAGAAAGGGGAAGGAAGGAGG - Intronic
1165863913 19:38924375-38924397 CTGTGAAGTGGGATGATAACAGG + Intronic
925068239 2:946809-946831 GTGTGAAACAGGAAGGTAATAGG + Intergenic
925773442 2:7307394-7307416 CTGAGAAATTGGAAGGTGACTGG - Intergenic
925814633 2:7735669-7735691 CTGTGACTGGGGAGGGTACCAGG - Intergenic
925814719 2:7736463-7736485 CTGTGACTGGGGAGGGTACCAGG - Intergenic
926394868 2:12430558-12430580 CTGAGAAAAGGGAAGGGAAAAGG + Intergenic
927199134 2:20567739-20567761 GGGTGAAAGGGCAAGGTCACAGG - Intronic
927207038 2:20617308-20617330 GTGTGAAGGGGGAAGGCAAATGG + Intronic
928243900 2:29610687-29610709 CTGTGAAAGGAAAAGGTCACTGG + Intronic
930673573 2:54176942-54176964 CTGTGAAAGGAGAGGGAAGCTGG - Intronic
931922637 2:67037723-67037745 CTGAGAAAGGGGTGGGAAACAGG + Intergenic
932050274 2:68391281-68391303 CAATGGAAGAGGAAGGTAACAGG - Intronic
932400158 2:71474930-71474952 CTGTGATAGGGGAGGGGAAGTGG + Intronic
934123574 2:88864056-88864078 CTGGGATGGGGGAAGGTAAAAGG + Intergenic
936309738 2:111374570-111374592 CTGTGAAAGAGGAAAGCCACTGG + Intergenic
936539708 2:113340371-113340393 CTGGAAAAGGGGAAGTTAAAAGG - Intergenic
936658158 2:114512289-114512311 ATGTGAAAGGTGAAGGAAATTGG - Intronic
936770843 2:115911250-115911272 CTGTGAGTGGGGAAGGTGAAAGG + Intergenic
936834683 2:116694305-116694327 CTATGAAAGGGGAAGGGATGAGG + Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937770239 2:125712384-125712406 CTGTGAAATGGGAATGTTAATGG + Intergenic
937985027 2:127634573-127634595 CTGGGGAAGGGGAAGGTACAGGG - Intronic
938274560 2:130006375-130006397 GGGTGAAAGGGTAAGGGAACTGG - Intergenic
938440807 2:131330897-131330919 GGGTGAAAGGGTAAGGGAACTGG + Intronic
939119775 2:138102308-138102330 CTGTGGAGGCAGAAGGTAACAGG - Intergenic
939128054 2:138202115-138202137 ACGTGAAAGGTGAAGGGAACTGG + Intergenic
939257952 2:139769309-139769331 CAGTGAAAGAGAAAGGTCACTGG + Intergenic
941356937 2:164504999-164505021 CTGCCAAAAGGCAAGGTAACTGG + Intronic
944513046 2:200483479-200483501 GGGTGAATGGGGCAGGTAACTGG + Intergenic
945884007 2:215355482-215355504 GTGTCAAAGGGCAAGGCAACGGG - Intergenic
946247955 2:218398029-218398051 CTGTGAAGGGGGCTGGTACCTGG - Intergenic
947388104 2:229612414-229612436 CTGTAAAGGGGGAAGGCATCTGG + Intronic
948934158 2:241151342-241151364 ATGTGAAAGGGGTAGGGAAGAGG + Intronic
1169005229 20:2201102-2201124 CTGTGAAATGCTCAGGTAACTGG + Intergenic
1169873495 20:10271864-10271886 CTGTGAAAAGGAAAGGTCAATGG + Intronic
1170829905 20:19830971-19830993 CTGTGGAATGGGAAGGAAGCAGG - Intergenic
1170914142 20:20606149-20606171 CTGTGAAAATGGAAGGAAAAGGG - Intronic
1171226031 20:23442801-23442823 CAGTGACAGGGCAAGGCAACAGG + Intronic
1172638211 20:36424160-36424182 CTGTGACAGGTGAAGGGGACAGG + Intronic
1173911107 20:46671626-46671648 CTGTGAAAAGGAAAAGGAACAGG + Intronic
1175878161 20:62240205-62240227 CTCAACAAGGGGAAGGTAACTGG - Intronic
1178062972 21:28872529-28872551 CTATGAAAGAGAAAGGTGACAGG - Exonic
1178277574 21:31252885-31252907 CTTTGAAAGGGCAAGGTAATTGG - Intronic
1178303969 21:31474940-31474962 CGGTGAAATGGGAAGATAATTGG + Intronic
1178574788 21:33776306-33776328 CTTTGAGAGGGCAAGGTAAGAGG + Intronic
1181404075 22:22669411-22669433 CTGTGAAGGGGGAACATCACTGG - Intergenic
1181802774 22:25358255-25358277 CTGTGAAAGAGGAAGGGACGGGG - Intronic
1181973925 22:26714735-26714757 CTGCGAGAGGGGAAGATAACAGG - Intergenic
1182080259 22:27523863-27523885 CTGTGAAATGGGTATGTAAATGG - Intergenic
1183892289 22:40939702-40939724 CTGTGAAAGGGCCAGTTAAGAGG - Intergenic
950549968 3:13660280-13660302 CTGTGAAAGGGGCAGGTGTTGGG + Intergenic
950761768 3:15236180-15236202 TTGTGAAAGGGGAAGAAAATAGG + Intronic
951054119 3:18127472-18127494 CTAAGAAAGAGGAATGTAACTGG + Intronic
951160094 3:19408291-19408313 GGGTGGAAGGGGAAGGTAAAGGG + Intronic
951289077 3:20853888-20853910 ATGAGAAAGGGGAAAGAAACTGG - Intergenic
954407556 3:50353910-50353932 CAGAGAAAGGGGAAGGAAATGGG - Exonic
954797409 3:53168606-53168628 CTGTGAAATGGGCAGATCACGGG + Intronic
959598409 3:108152442-108152464 CTGATAAGGGGGAGGGTAACAGG + Intergenic
960614397 3:119583666-119583688 CTGTGAAAGGCCAAGGTGAGAGG + Intronic
961864825 3:129945997-129946019 CTGTGAAATGGGAGGGTGAATGG - Intergenic
963193159 3:142496116-142496138 CCTTGAAATGGGAAGGTATCTGG + Intronic
963496853 3:146075147-146075169 CTGTGAAAGAGGAAGGTATGTGG + Intronic
964540618 3:157775250-157775272 CTCTGATAGGGAAAGGCAACAGG + Intergenic
969164931 4:5299293-5299315 CAGTGAAAAGGGAAGGAAACAGG + Intronic
969331895 4:6478627-6478649 CTGGCAAAGGGGGAGGTAGCAGG - Intronic
969985095 4:11200334-11200356 CTCTGAAAGTGCAGGGTAACAGG + Intergenic
971327243 4:25654743-25654765 CTGTGCAAGGGGAAGGACTCGGG - Intergenic
972575023 4:40343624-40343646 CTGAGGAAAGGGAAGGTAAGAGG + Intronic
974348443 4:60713329-60713351 CAGTGAAAGGAAAAGGAAACAGG + Intergenic
975245109 4:72111527-72111549 CTGTTAATGGGGAAGCTAATGGG + Intronic
975902133 4:79165474-79165496 CTGTGCAAAGGGAGAGTAACAGG - Intergenic
977055607 4:92186848-92186870 CTGTGAAAGAAGAAGGTTTCAGG + Intergenic
978293533 4:107175530-107175552 CTGCCATAGGAGAAGGTAACTGG - Intronic
980617411 4:135248710-135248732 CTCTGAAATGGTAAGGAAACTGG - Intergenic
982329257 4:154163178-154163200 GGGTGAAAGGGGAAAGTCACAGG + Intergenic
983023359 4:162707249-162707271 ATATGAAAGGGTAAGGTAAGGGG + Intergenic
984946107 4:184969798-184969820 GTGTGAAAGGTGAAGACAACTGG - Intergenic
985812768 5:2102346-2102368 CTGTGAAAGGCCAAGGTGGCTGG - Intergenic
987096356 5:14554103-14554125 CTGTTAAGGGGGAAGGGAACGGG + Intergenic
988299548 5:29404354-29404376 CTTTGGAAAGGGAAGGTAAGAGG + Intergenic
990661268 5:58018161-58018183 ATGTGTAAGGCTAAGGTAACTGG - Intergenic
994999829 5:107113353-107113375 TTGTGAAAGTAGAAGGCAACTGG - Intergenic
997008384 5:129847873-129847895 AGGTGAAAGGGGATGGTAAAAGG - Intergenic
998488269 5:142523014-142523036 CTGTGAATGGGGAAAGAAAGGGG - Intergenic
1000070928 5:157740508-157740530 CTCTGAAGGGGGAAGGTAGTGGG + Exonic
1000245953 5:159448736-159448758 CTCTGAGAGGGGAAGGAAGCGGG + Intergenic
1001887574 5:175309284-175309306 CAGTGAAAGGGCAAGGTATCTGG - Intergenic
1002916886 6:1536664-1536686 CTGAGATGGGGGAAGTTAACGGG - Intergenic
1006047541 6:31309597-31309619 CTATGAAAGGGAAAAATAACAGG + Intronic
1006170979 6:32092433-32092455 CTGGGAAGAGGGAAGGTAAGAGG + Intronic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006560010 6:34902883-34902905 ATGTTAAAGAGAAAGGTAACCGG - Intronic
1007563368 6:42829162-42829184 CTGTTAAATGGAACGGTAACAGG - Exonic
1009533253 6:64847755-64847777 CTGGGAAAAGGGAAAATAACTGG - Intronic
1009811654 6:68675714-68675736 CACTTACAGGGGAAGGTAACTGG - Intronic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1012977415 6:105794871-105794893 CTGGGAAAAGGGAAGGGAACTGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014583913 6:123174314-123174336 TTGTCAAAGGGGAAGTTTACGGG + Intergenic
1016074068 6:139775531-139775553 GATTGAAAGGGGAGGGTAACTGG + Intergenic
1017248086 6:152249388-152249410 CTGTGCTATGGGAAGGTAAAAGG + Intronic
1019947183 7:4339120-4339142 CAGTCACAGTGGAAGGTAACGGG + Intergenic
1020579406 7:9976068-9976090 CTGTGAAAGGCCAAGGTGAGCGG - Intergenic
1020803172 7:12756842-12756864 CTGGGAAAGGAGAAGGAAACTGG + Intergenic
1022527504 7:31048078-31048100 CTGTGAAAGGGGGTGGTAAATGG + Intergenic
1023200349 7:37690419-37690441 CTGTGAAAGGGGAAAGGACAGGG - Intronic
1024089792 7:45925806-45925828 CAGTGAAAGGGATAGATAACAGG - Intergenic
1025092882 7:56077982-56078004 CTGGGGAAGGGGAAGGGCACGGG - Intronic
1025797932 7:64757388-64757410 CTGTGGAAGGGGACGGCAGCAGG + Intergenic
1028694623 7:93694258-93694280 ATGTGAGAGGGGATGGCAACTGG - Intronic
1031895758 7:127346823-127346845 CTGTGAAAGGAGAGGGGAACTGG + Intronic
1034051997 7:147993873-147993895 TTGTGAAGGGGGAAGGAAACAGG - Intronic
1035076608 7:156181862-156181884 CTGGGAAAGGGGAAGAGCACTGG - Intergenic
1035676950 8:1462693-1462715 CTGGGGAAGGGGAAGGGACCAGG + Intergenic
1035795230 8:2350034-2350056 TGGTGAAAGGGGAAGCAAACAGG - Intergenic
1035959616 8:4122740-4122762 CTGTGAAAGGGGAAGATTTCTGG + Intronic
1036421691 8:8602087-8602109 CTGACAAAGGGGAAGGAAACAGG - Intergenic
1036478755 8:9119004-9119026 GTGTGAAGGGGGAAGAGAACTGG - Intergenic
1036543389 8:9741436-9741458 CTGTGAAAGGTGAAGGCTAATGG - Intronic
1039290148 8:36085888-36085910 GTGTGGCAGGGGAAGGGAACAGG + Intergenic
1042432200 8:68720680-68720702 CTGTGATAGGGATAGGTAAATGG - Intronic
1042749837 8:72146723-72146745 CTGGGAAAGGGGAAGGGATAGGG + Intergenic
1043850135 8:85206448-85206470 GTGTGGAAGGGGAAGGGGACAGG + Intronic
1044738494 8:95302315-95302337 CTGTGAAATGGGAATGGAAAGGG + Intergenic
1046094032 8:109537402-109537424 CTTTGAAAGGGGAGAGTAAGTGG + Intergenic
1047015698 8:120720849-120720871 CTGTGGAAGGGTAAGGTAGGTGG - Intronic
1047367222 8:124222648-124222670 CAGTGGAAGGAGAGGGTAACAGG - Intergenic
1049032778 8:140049648-140049670 AGCTGAAAGGGGAAGGTCACAGG + Intronic
1049157625 8:141076466-141076488 CTGGGACAGGGGAAGGTAAATGG + Intergenic
1050242095 9:3647468-3647490 TTGTGAAAGGGTAAGAGAACTGG + Intergenic
1050366430 9:4877801-4877823 CTCTGAAAAGGGGAGGTAGCGGG - Intronic
1051512679 9:17896520-17896542 TTGTGGAAGGGGACGGAAACAGG + Intergenic
1053182418 9:35984661-35984683 CTGTAAGTGAGGAAGGTAACAGG + Intergenic
1055633442 9:78248454-78248476 CTGGGAAGGGGGAAGATCACTGG - Intronic
1057269696 9:93643896-93643918 CTGAGAAAGTGGGAGGGAACAGG - Intronic
1057453077 9:95182879-95182901 CTGGGACAGGGGAAGGTGACTGG + Intronic
1058954909 9:109937099-109937121 CTGCCAAAGGTGAAGGCAACAGG + Intronic
1059098705 9:111447871-111447893 CTGTGAAAGGACAAGGGAAAAGG - Intronic
1060198632 9:121639123-121639145 CTGTAAAATGGGAGAGTAACAGG + Intronic
1061427769 9:130510964-130510986 CTGAGAAAAGGGAAACTAACAGG - Intergenic
1187216193 X:17279248-17279270 CTGTGAAAAGGGAAAGAACCAGG - Intergenic
1187585913 X:20661828-20661850 CTCTGAAATGGAAAGGAAACAGG - Intergenic
1189543868 X:42021531-42021553 CCAAGAAAGGGGAAGGGAACTGG - Intergenic
1195317705 X:103694931-103694953 CTTAGAAAGGGGAAAGTAATGGG - Intergenic
1195940623 X:110164716-110164738 CTGTGAAAGGGAAGGATAGCGGG + Intronic
1197125563 X:122941829-122941851 ATGTGAAGGGGAAAGGTTACTGG + Intergenic
1197307053 X:124855662-124855684 CTCTGAAAGTGCAGGGTAACAGG + Intronic
1197807469 X:130411613-130411635 GTGTGAAAGGGGAAGGTGTGGGG + Intronic
1198436475 X:136621631-136621653 GTTTGAAAGGTGAAGATAACAGG + Intergenic
1201361319 Y:13153069-13153091 CAGTGAGAGGTGAAGGTAGCTGG - Intergenic