ID: 1160933315

View in Genome Browser
Species Human (GRCh38)
Location 19:1580982-1581004
Sequence CCGTCTCCCCACGATGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 107}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160933315_1160933321 -2 Left 1160933315 19:1580982-1581004 CCAGCAGCATCGTGGGGAGACGG 0: 1
1: 0
2: 1
3: 10
4: 107
Right 1160933321 19:1581003-1581025 GGGAAGCACGCAGGCACACGGGG 0: 1
1: 0
2: 2
3: 15
4: 121
1160933315_1160933322 7 Left 1160933315 19:1580982-1581004 CCAGCAGCATCGTGGGGAGACGG 0: 1
1: 0
2: 1
3: 10
4: 107
Right 1160933322 19:1581012-1581034 GCAGGCACACGGGGACACTCAGG 0: 1
1: 0
2: 1
3: 31
4: 214
1160933315_1160933319 -4 Left 1160933315 19:1580982-1581004 CCAGCAGCATCGTGGGGAGACGG 0: 1
1: 0
2: 1
3: 10
4: 107
Right 1160933319 19:1581001-1581023 ACGGGAAGCACGCAGGCACACGG 0: 1
1: 0
2: 0
3: 9
4: 106
1160933315_1160933324 17 Left 1160933315 19:1580982-1581004 CCAGCAGCATCGTGGGGAGACGG 0: 1
1: 0
2: 1
3: 10
4: 107
Right 1160933324 19:1581022-1581044 GGGGACACTCAGGGTCCCCACGG 0: 1
1: 1
2: 2
3: 37
4: 324
1160933315_1160933320 -3 Left 1160933315 19:1580982-1581004 CCAGCAGCATCGTGGGGAGACGG 0: 1
1: 0
2: 1
3: 10
4: 107
Right 1160933320 19:1581002-1581024 CGGGAAGCACGCAGGCACACGGG 0: 1
1: 0
2: 0
3: 5
4: 121
1160933315_1160933323 8 Left 1160933315 19:1580982-1581004 CCAGCAGCATCGTGGGGAGACGG 0: 1
1: 0
2: 1
3: 10
4: 107
Right 1160933323 19:1581013-1581035 CAGGCACACGGGGACACTCAGGG 0: 1
1: 0
2: 0
3: 14
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160933315 Original CRISPR CCGTCTCCCCACGATGCTGC TGG (reversed) Intronic
900484830 1:2917503-2917525 CCGCCTCGCCACGATGCTTCAGG - Intergenic
902416725 1:16244159-16244181 CCCTCTCCCCAGGCTTCTGCTGG + Intergenic
903649524 1:24914354-24914376 CCGGCGCCCCACCCTGCTGCTGG - Intronic
903739272 1:25549298-25549320 CCATCTCCCCACCAGGCTGGGGG + Intronic
904312802 1:29640218-29640240 CCATCTCACCAGGCTGCTGCAGG - Intergenic
905530916 1:38678041-38678063 CCCTCTCCCCACACTGCTGTGGG + Intergenic
917069586 1:171135572-171135594 CCTCCTCCCCATGATGCTGATGG + Intergenic
923097546 1:230787621-230787643 CCATCTCCCCACCAGGCTGAGGG + Intronic
1062811614 10:470663-470685 CTCTCTCTCCACGATGCTGCAGG - Intronic
1064035485 10:11910341-11910363 CCGTCTCCCCAAGATGAGGTGGG + Intergenic
1067314791 10:45151305-45151327 CCGTCACCCCCAGATGCTGTGGG - Intergenic
1068910565 10:62374546-62374568 CCAACTCCCCGCCATGCTGCGGG - Intronic
1075697629 10:124448138-124448160 CCTTCTCCCCTAGATGCTGCGGG - Exonic
1084218428 11:67663981-67664003 CCGGCTCCCCATGATCCTGCAGG - Intronic
1085446842 11:76606426-76606448 CTGTATCCCCACGACGCTGAGGG - Intergenic
1087698313 11:101406903-101406925 CCGACTCCCCACCTTGATGCAGG - Intergenic
1089979932 11:122763854-122763876 CCTTCTCCCCATGAGGCTGAGGG - Intronic
1091980174 12:4858287-4858309 CCTTCTCTCCACGACGCTCCTGG - Intergenic
1096497640 12:52047635-52047657 CCACCTCCCCAAGCTGCTGCAGG - Intronic
1096976230 12:55700581-55700603 CCGTCTCCGCACGCTGCTGCTGG - Intronic
1101430388 12:104621924-104621946 CAGACTCACCACGCTGCTGCCGG - Intronic
1101813602 12:108129194-108129216 CCGGCTCCCCGGGAGGCTGCGGG + Intergenic
1121267393 14:92613180-92613202 CTGTCTCCCCTCTCTGCTGCCGG + Intronic
1121518079 14:94567043-94567065 CCGGGTGCCCATGATGCTGCAGG + Exonic
1123161930 14:106287057-106287079 CCGGCTGCCCACGGCGCTGCAGG - Intergenic
1123179972 14:106460452-106460474 CCGGCTGCCCACGGCGCTGCAGG - Intergenic
1123448630 15:20346555-20346577 CCAGCTGCCCACGAGGCTGCTGG - Intergenic
1125398550 15:39275518-39275540 CCGCCTCTCCTCGCTGCTGCTGG + Intergenic
1127936225 15:63641490-63641512 GCGGCTCCCCATGATGCTTCAGG - Exonic
1128304014 15:66586404-66586426 CCGTCTCCCCTCGGTGCTGGAGG - Intronic
1131438274 15:92439931-92439953 CCGCCTCCCCCGGATACTGCTGG - Intronic
1132227217 15:100151668-100151690 CCTTCTCCACAGGATGGTGCAGG + Intronic
1134019099 16:10909065-10909087 TGGTCTCCCCATGCTGCTGCAGG - Exonic
1138380885 16:56601549-56601571 CCTTCTCCCCAGGAGGCTGTGGG - Intergenic
1138505761 16:57477549-57477571 CCTTCTGCCCCTGATGCTGCGGG - Intronic
1141697462 16:85626814-85626836 CCCCCTCCCCACGAGGCTGGAGG - Intronic
1142238512 16:88934501-88934523 CTGTCGCCCCCCGATGGTGCCGG - Intronic
1142566524 17:843798-843820 CCATCTCCCAAAGACGCTGCAGG - Intronic
1143181264 17:4985939-4985961 CTTTCTCCCCAAGAAGCTGCTGG - Exonic
1143758925 17:9087248-9087270 CCCTCTCCCCAGAATGCTCCTGG - Intronic
1144873221 17:18382983-18383005 CTCTCTCCCCACCCTGCTGCTGG + Intronic
1145264250 17:21371950-21371972 CCATGTCCCCACAATGCTCCTGG + Intergenic
1148161125 17:45450753-45450775 CCATCTCCCCAGGCTGCTCCCGG - Exonic
1148835736 17:50464852-50464874 CCTTCTCCCCAGGACACTGCTGG + Exonic
1148997515 17:51723984-51724006 CTGGCTCCCAACGGTGCTGCAGG + Intronic
1150392359 17:64797399-64797421 CCATCTCCCCAGGCTGCTCCCGG - Intergenic
1151482801 17:74380141-74380163 CCCTCTCTCCACGGTGCTGGAGG + Intergenic
1151748020 17:76022048-76022070 CTGTCTCCCCACCCTGCTGCTGG - Intronic
1152207911 17:78985099-78985121 CTGTCTTCCCACCATGGTGCTGG - Intergenic
1152610711 17:81313890-81313912 CCGGCCCCCCACCCTGCTGCAGG - Exonic
1160516201 18:79480479-79480501 CCACCTCCCCAGGATGCTGGCGG - Intronic
1160782717 19:884961-884983 CCAGCACTCCACGATGCTGCTGG + Exonic
1160933315 19:1580982-1581004 CCGTCTCCCCACGATGCTGCTGG - Intronic
1161304691 19:3560552-3560574 CCGGCTGCCCACGGTGATGCAGG + Intronic
1163523995 19:17809162-17809184 CTGTCTCCCCATGAGGCTGGGGG + Intronic
1163575969 19:18110818-18110840 CGGTCTCCTCAAGATACTGCAGG + Intronic
1164537732 19:29098956-29098978 CCCTGCCCCCATGATGCTGCTGG + Intergenic
1164711596 19:30360693-30360715 CCGACTTCCCAGGATTCTGCTGG + Intronic
1165333626 19:35154766-35154788 CCCTCTCTCCACGAGGCTGCCGG + Exonic
1166777448 19:45321824-45321846 CCGTCTCCCACCGCTGCTGGAGG - Intronic
1166824786 19:45602054-45602076 CCGGCTGCCCGCGATGCTGCGGG - Intronic
925882038 2:8360989-8361011 CCCTCTCCCCAGGATGCGGAAGG + Intergenic
927511970 2:23649597-23649619 CCCTCTCTCCACGGGGCTGCGGG + Intronic
927553969 2:24019873-24019895 CCGAATCCACACGCTGCTGCTGG + Intronic
929684628 2:44023112-44023134 CCTTCTCCCCAGGCTGCTCCTGG - Intergenic
931958916 2:67459757-67459779 ACTTCTACCCAAGATGCTGCAGG - Intergenic
936525710 2:113240229-113240251 CCCTCTCCCCATGCTGCTGATGG + Intronic
937506559 2:122543947-122543969 CCATCTTCCCATGATTCTGCAGG - Intergenic
940984884 2:160043133-160043155 CTGTCTCCCCGCCATACTGCGGG + Intronic
942346116 2:175004861-175004883 CCGTCTCCCCGCGCCGCCGCAGG - Intronic
945446222 2:209941468-209941490 GATTCTCCCCACCATGCTGCAGG + Exonic
947797183 2:232901892-232901914 CCGTGTCTCCAGTATGCTGCTGG + Intronic
948352180 2:237350146-237350168 CCGTCTCCCCACGAGGGCCCCGG + Exonic
948471406 2:238182931-238182953 ACCCCTCCCCACGATGCTTCTGG - Intronic
948806214 2:240454351-240454373 CCCTCACCCCAGGAGGCTGCTGG + Intronic
1170395680 20:15922761-15922783 CTGTCTCCCCAGCATGCTTCTGG + Intronic
1172698046 20:36835716-36835738 TCCTCTCCCCACGCTGCAGCTGG - Intronic
1175550503 20:59814258-59814280 CCGCGTCCCCAGGATGGTGCTGG - Intronic
1178233397 21:30813173-30813195 CTGTCTTCCCAGGATGCTACTGG - Exonic
1178414083 21:32389686-32389708 CCTTCTCCCCACATTGCTTCTGG - Intronic
1180999250 22:19980375-19980397 CTGTGTCCCCACCATGCTCCGGG - Intronic
1181426796 22:22849002-22849024 TCAGCTCCCCAGGATGCTGCTGG - Intronic
1181947215 22:26527713-26527735 CCGCCTCCCAAGGATGCTGAGGG + Intronic
1182041215 22:27240158-27240180 CCATCTCCCCACTAGGCTGGGGG + Intergenic
1184287287 22:43478759-43478781 CCGTCCACCCACCGTGCTGCTGG + Intronic
952942682 3:38455496-38455518 CGGAGTCCCCACGCTGCTGCGGG + Intronic
952957224 3:38564863-38564885 CCAACTGCCCAAGATGCTGCAGG + Intronic
964813976 3:160696561-160696583 CTGTCTCCCCACAGTGCTCCAGG + Intergenic
973695596 4:53487515-53487537 CCCTCTCCCCACAATGCCCCAGG + Intronic
981097121 4:140793220-140793242 CCATCTCCCCACCAGGCTGTTGG + Intergenic
985836888 5:2278147-2278169 CTGACGCTCCACGATGCTGCCGG + Intergenic
986825150 5:11512323-11512345 CCGTCTCTACACATTGCTGCTGG + Intronic
991371676 5:65925940-65925962 CCGTCTCCTCACGAGCTTGCGGG - Intergenic
997588554 5:135059090-135059112 CCCACTGCCCAGGATGCTGCTGG + Intronic
999950177 5:156640864-156640886 GTGTCTCCCCAGGCTGCTGCTGG - Intronic
1000382093 5:160638432-160638454 CTGTGTCCCCAAGATGCTGCAGG - Intronic
1002290426 5:178196680-178196702 CTGTCTCTCCACCATCCTGCAGG - Intergenic
1004524298 6:16391855-16391877 CCTTCTCCCCTCCAGGCTGCTGG - Intronic
1007912565 6:45530576-45530598 CTGTCTCCAGAGGATGCTGCTGG + Intronic
1013768136 6:113597010-113597032 AAGTGTCCCCATGATGCTGCTGG + Intergenic
1022471082 7:30682286-30682308 CCCTCTCCGCACGCGGCTGCGGG - Intronic
1026186374 7:68084813-68084835 CCCACTCCCCTCGATACTGCTGG + Intergenic
1026736152 7:72949934-72949956 CTGTCTCCCAGCCATGCTGCTGG - Exonic
1026786495 7:73304835-73304857 CTGTCTCCCAGCCATGCTGCTGG - Exonic
1027107577 7:75415125-75415147 CTGTCTCCCAGCCATGCTGCTGG + Intergenic
1033537276 7:142323833-142323855 CCGTGGCCCCACTATGCTGCAGG + Intergenic
1040486995 8:47883088-47883110 CACTCTCATCACGATGCTGCTGG - Intronic
1041526591 8:58813341-58813363 CAGTTTCCTCACCATGCTGCGGG - Intronic
1047401994 8:124555889-124555911 CCATCTCCTCACCAGGCTGCAGG + Exonic
1049279736 8:141738171-141738193 CCGTCTCCCCCCGGGGCTCCTGG - Intergenic
1049482861 8:142835092-142835114 GCGTCTCCCCAGGAACCTGCGGG - Intronic
1053397139 9:37785327-37785349 TCGTATCCCCACGATGCGACCGG - Intronic
1057079112 9:92159174-92159196 CCGCCTCCCCAGGCTGCTGTGGG - Intergenic
1057904640 9:98974534-98974556 CGGTCTGCCCCCCATGCTGCAGG + Intronic
1059801545 9:117754123-117754145 CCGTCTTCCCACTAGACTGCAGG + Intergenic
1059939489 9:119344028-119344050 CCATCTCCCCAACATGCTGTAGG - Intronic
1060009997 9:120035443-120035465 CCATCTCCACATGATCCTGCTGG - Intergenic
1061416897 9:130451922-130451944 CCGCCTTCCCTCGATGCTGGAGG + Exonic
1188003189 X:25001082-25001104 CCCTCACCCCAAGATGCTGTGGG + Intergenic